ID: 1145815720

View in Genome Browser
Species Human (GRCh38)
Location 17:27793702-27793724
Sequence CTCCTTAGGCGCAGCTCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145815716_1145815720 -6 Left 1145815716 17:27793685-27793707 CCTCGCGCATGGCCCGGCTCCTT 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1145815712_1145815720 0 Left 1145815712 17:27793679-27793701 CCAGCCCCTCGCGCATGGCCCGG 0: 1
1: 0
2: 0
3: 21
4: 184
Right 1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1145815715_1145815720 -5 Left 1145815715 17:27793684-27793706 CCCTCGCGCATGGCCCGGCTCCT 0: 1
1: 0
2: 2
3: 12
4: 148
Right 1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1145815707_1145815720 22 Left 1145815707 17:27793657-27793679 CCGGCGGCCTCGCACGCCGCGCC 0: 1
1: 0
2: 1
3: 25
4: 235
Right 1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1145815714_1145815720 -4 Left 1145815714 17:27793683-27793705 CCCCTCGCGCATGGCCCGGCTCC 0: 1
1: 0
2: 1
3: 3
4: 108
Right 1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1145815709_1145815720 6 Left 1145815709 17:27793673-27793695 CCGCGCCCAGCCCCTCGCGCATG 0: 1
1: 0
2: 1
3: 31
4: 333
Right 1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1145815706_1145815720 23 Left 1145815706 17:27793656-27793678 CCCGGCGGCCTCGCACGCCGCGC 0: 1
1: 0
2: 1
3: 11
4: 174
Right 1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1145815705_1145815720 29 Left 1145815705 17:27793650-27793672 CCGGGGCCCGGCGGCCTCGCACG 0: 1
1: 0
2: 0
3: 15
4: 204
Right 1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1145815708_1145815720 15 Left 1145815708 17:27793664-27793686 CCTCGCACGCCGCGCCCAGCCCC 0: 1
1: 0
2: 9
3: 101
4: 935
Right 1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1145815711_1145815720 1 Left 1145815711 17:27793678-27793700 CCCAGCCCCTCGCGCATGGCCCG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145815720 Original CRISPR CTCCTTAGGCGCAGCTCCGC TGG Intronic
901668951 1:10842949-10842971 CTCCTGGGGCCCAGTTCCGCAGG + Intergenic
903181913 1:21609085-21609107 CTCCCTGGGCTCAGCTCCCCAGG + Intronic
922131848 1:222787718-222787740 CTCCTTATGTGCAGCTACGGAGG - Intergenic
1068989129 10:63133288-63133310 CTCCTCCGGCGCCGCGCCGCGGG - Exonic
1075278847 10:121121349-121121371 CTCTTTATGCCCAGCTCCTCTGG - Intergenic
1077123462 11:921773-921795 CTCCTTAGGAGAAGCTGGGCAGG + Intergenic
1078987152 11:16607380-16607402 CTCCTTGTGCGCTGCGCCGCAGG + Intronic
1084884995 11:72198064-72198086 CAGCTTAGGCCCAGCTCCTCTGG - Intergenic
1091660552 12:2380063-2380085 CTCCTTTGGCACAGGTCCCCTGG + Intronic
1091973740 12:4809445-4809467 CTCCCTAGGAGCCGCGCCGCAGG - Exonic
1092356074 12:7796530-7796552 CACCTTAAGAGCAGCTACGCAGG + Exonic
1104602104 12:130161452-130161474 CTCCTTGGCTGCAGCCCCGCAGG - Intergenic
1104850844 12:131872914-131872936 CTCCTTAAGCGCTGCCCCCCAGG + Intergenic
1105847833 13:24308388-24308410 CCCCTGAGTCCCAGCTCCGCTGG - Intronic
1106833479 13:33610460-33610482 CTCCCTGGGCACAGCACCGCAGG + Intergenic
1113386931 13:109857521-109857543 TTCCCTAGGCTCAGCTCTGCAGG - Intergenic
1128569040 15:68720012-68720034 CTCTTTTGGGGCAGCTCGGCTGG + Intronic
1129727497 15:77909083-77909105 CTCACTAGGCGGAGCTCAGCTGG - Intergenic
1129840381 15:78739890-78739912 CTCGCTAGGCGGAGCTCAGCTGG + Intergenic
1130258518 15:82337103-82337125 CTCGCTAGGCGGAGCTCAGCTGG - Intergenic
1130275809 15:82475866-82475888 CTCGCTAGGCGGAGCTCAGCTGG - Intergenic
1130462501 15:84169296-84169318 CTCTCTAGGCGGAGCTCAGCTGG + Intergenic
1130468168 15:84203258-84203280 CTCGCTAGGCGGAGCTCAGCTGG - Intergenic
1130496096 15:84470284-84470306 CTCGCTAGGCGGAGCTCAGCTGG + Intergenic
1130590461 15:85207856-85207878 CTCGCTAGGCGGAGCTCAGCTGG - Intergenic
1130596408 15:85252857-85252879 CTCGCTAGGCGGAGCTCAGCTGG + Intergenic
1144548022 17:16215556-16215578 CGCCTTAGCCGCGGCTCCGCGGG - Intronic
1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG + Intronic
1146039036 17:29433743-29433765 CTCCTGAGGCTCAGCTCCAGTGG + Intronic
1147161817 17:38572933-38572955 CTCCCTCGGCGCGGCCCCGCCGG + Intronic
1147549075 17:41425739-41425761 CTCCTTAGGCCCAGCACTGACGG - Intergenic
1152773955 17:82188272-82188294 CCCTCGAGGCGCAGCTCCGCAGG - Exonic
1160623447 18:80187161-80187183 GTCCTTAGGAGCAGCCCCACTGG - Intronic
1160769235 19:822701-822723 CTCCATATGCGCAGCCCTGCGGG + Intergenic
1160905583 19:1450269-1450291 CTCCCTCTGCGCGGCTCCGCGGG - Intronic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1167532217 19:50025206-50025228 CCCCCTAGCCGCAGCTCGGCCGG - Intronic
1168524335 19:57076760-57076782 CACCTCAGGCGCACCTCCTCAGG - Intergenic
932445048 2:71775439-71775461 TTCCTTAGCCCCAGCTCCCCAGG + Intergenic
1174259093 20:49280418-49280440 CTCCTTTGTCCCAGCTCCCCTGG + Intergenic
1174503152 20:51000229-51000251 CTCCCTGGGCGCATCCCCGCAGG + Intergenic
950438721 3:12994954-12994976 CTCCTTAGGTGCACCCCCGCGGG - Intronic
956229596 3:66998575-66998597 CTCCTGGGGCGCAGCGCCGGCGG - Intronic
968547569 4:1206643-1206665 CTCCCCAGGCTCAGCTCTGCAGG + Intronic
970508272 4:16754977-16754999 CTCCTGAGGCCCATCTCAGCAGG - Intronic
978777190 4:112515966-112515988 CTACTGTGGCGCAGCTCCGCGGG + Exonic
979523711 4:121696676-121696698 CTCCCCAAGCGCAGGTCCGCGGG + Intronic
981827608 4:148961572-148961594 CTCTTTAGGCGTAGCTCTTCAGG - Intergenic
995526476 5:113054551-113054573 CCCCTTCGGTGCTGCTCCGCAGG - Intronic
997984573 5:138492275-138492297 CTCCTTGGCAGCAGGTCCGCTGG - Intergenic
999461064 5:151758159-151758181 CTCCTTCAGGCCAGCTCCGCGGG + Intronic
1009723811 6:67510167-67510189 TTCCTTAGGAGCAGCTTCACTGG - Intergenic
1019256671 7:56843-56865 CTCCTCAGGCTCAGCAGCGCCGG + Intergenic
1021104052 7:16616738-16616760 CTCCCCAGGCGCGCCTCCGCTGG - Intronic
1024452504 7:49563838-49563860 CTCCTATGGGGCAGCTCGGCAGG - Intergenic
1028477099 7:91264845-91264867 CTCTCTTGGCGCCGCTCCGCTGG - Exonic
1035426797 7:158783600-158783622 CTCCTTCGGGGCAGCTCTGAGGG + Intronic
1052202508 9:25799791-25799813 CTCCTAAGGCATAGCTCTGCAGG + Intergenic
1053240052 9:36487768-36487790 CTCCTCAGCCGCGGCTCCGGGGG + Intergenic
1186869620 X:13757652-13757674 CTTCTTAGGCCTAGCTCAGCCGG + Exonic
1197951533 X:131902912-131902934 CTCCTTAGGCTCTGCACCGTTGG + Intergenic
1200225552 X:154415216-154415238 CTCCTTAGTCCCAGCTGCTCAGG - Intronic
1202372644 Y:24209114-24209136 CTCTCTAGGCGGAGCTCAGCTGG - Intergenic
1202489854 Y:25393839-25393861 CTCTTTTGGCTCAGCTCTGCCGG + Intergenic
1202498140 Y:25461006-25461028 CTCTCTAGGCGGAGCTCAGCTGG + Intergenic