ID: 1145815783

View in Genome Browser
Species Human (GRCh38)
Location 17:27793898-27793920
Sequence TCCGCGGCAGACGCCGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145815783_1145815788 -7 Left 1145815783 17:27793898-27793920 CCGCAGCCGGCGTCTGCCGCGGA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1145815788 17:27793914-27793936 CCGCGGAGTTTGGATGGCACTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1145815783_1145815789 4 Left 1145815783 17:27793898-27793920 CCGCAGCCGGCGTCTGCCGCGGA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1145815789 17:27793925-27793947 GGATGGCACTGGACTGTGTCTGG 0: 1
1: 2
2: 0
3: 15
4: 165
1145815783_1145815792 19 Left 1145815783 17:27793898-27793920 CCGCAGCCGGCGTCTGCCGCGGA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1145815792 17:27793940-27793962 GTGTCTGGGCTAAGATGCCCGGG 0: 1
1: 0
2: 0
3: 16
4: 136
1145815783_1145815794 29 Left 1145815783 17:27793898-27793920 CCGCAGCCGGCGTCTGCCGCGGA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1145815794 17:27793950-27793972 TAAGATGCCCGGGTCGTGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1145815783_1145815793 28 Left 1145815783 17:27793898-27793920 CCGCAGCCGGCGTCTGCCGCGGA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1145815793 17:27793949-27793971 CTAAGATGCCCGGGTCGTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 18
1145815783_1145815791 18 Left 1145815783 17:27793898-27793920 CCGCAGCCGGCGTCTGCCGCGGA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1145815791 17:27793939-27793961 TGTGTCTGGGCTAAGATGCCCGG 0: 1
1: 0
2: 1
3: 11
4: 208
1145815783_1145815790 5 Left 1145815783 17:27793898-27793920 CCGCAGCCGGCGTCTGCCGCGGA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1145815790 17:27793926-27793948 GATGGCACTGGACTGTGTCTGGG 0: 1
1: 0
2: 1
3: 22
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145815783 Original CRISPR TCCGCGGCAGACGCCGGCTG CGG (reversed) Intronic
901525817 1:9823244-9823266 TCAGCGGCGCACGCAGGCTGGGG - Intronic
910676395 1:89820953-89820975 GTCGCGGCACTCGCCGGCTGCGG + Intronic
1069832818 10:71291477-71291499 TCCGCGGTAGATGCCGGCGCTGG - Exonic
1075811343 10:125227114-125227136 TCCGCAGCACAGGCTGGCTGAGG + Intergenic
1084307473 11:68296515-68296537 TCTGCAGCTGACGCAGGCTGTGG + Intergenic
1090400338 11:126444800-126444822 TCCCCGTCAGACCCAGGCTGAGG - Intronic
1094041078 12:26122481-26122503 GCCGCGGCGGCCGCGGGCTGCGG + Exonic
1104692594 12:130838630-130838652 CCCGGGGCTGACGCCAGCTGCGG + Intronic
1105038848 12:132946363-132946385 CCCTGGGCAGACGCAGGCTGGGG + Intronic
1105896101 13:24718497-24718519 CCCGGGGAAGAGGCCGGCTGGGG + Intergenic
1111672657 13:91348669-91348691 GCCGCGGCTGAGGCCGACTGCGG - Intergenic
1113200742 13:107866175-107866197 TCCCCGGGAGACGGCGGCGGCGG - Exonic
1113795602 13:113055983-113056005 TCCGCAGCAGACACCCGCAGAGG + Intronic
1122736881 14:103848149-103848171 GCCGCGGAAGACGCCGGTGGGGG - Intergenic
1125534669 15:40436343-40436365 GCTGCGGCAGCCTCCGGCTGAGG - Intergenic
1125814895 15:42575770-42575792 TCCGCGGGAGAGGGCGCCTGAGG + Intronic
1135419755 16:22297755-22297777 GCCGCGGCCGACGCTGGCGGCGG + Intronic
1139215478 16:65122039-65122061 TCCGCGGCCGCCGCCAGCTGAGG - Exonic
1141577428 16:84973118-84973140 CCCGTGGCAGAGGCTGGCTGGGG + Intergenic
1141688230 16:85582339-85582361 TCCACTGCAGAAGCTGGCTGCGG + Intergenic
1142695152 17:1629207-1629229 GCCGCGGGAGAGCCCGGCTGGGG - Intergenic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1145815783 17:27793898-27793920 TCCGCGGCAGACGCCGGCTGCGG - Intronic
1147606377 17:41775993-41776015 TCCTTGGCAGGTGCCGGCTGGGG - Intronic
1152548069 17:81012976-81012998 TCCCAGGCAGATGCCTGCTGCGG + Intergenic
1160537772 18:79604118-79604140 TGTGAGGCAGAGGCCGGCTGAGG - Intergenic
1162031340 19:7918717-7918739 CCCGCGGCAGGCGCGGGCTTTGG + Intronic
1162118234 19:8445153-8445175 TCCGCGGCCGACGCGGGCGGCGG + Intronic
1167721235 19:51181853-51181875 TCCCCGGCAGTCCTCGGCTGCGG - Intergenic
945272306 2:207953502-207953524 TCCGCTGCACAAGCCGGGTGTGG + Intronic
946692397 2:222319458-222319480 TCCTCGGCAGGCGGCGGCGGCGG + Intergenic
1172062614 20:32196777-32196799 GCCGCAGCTGCCGCCGGCTGAGG + Exonic
1175096475 20:56545166-56545188 TCCCCAGCAGACACCAGCTGGGG - Intergenic
1179989581 21:44940160-44940182 CCCGCGGCCGAGGCCGGCGGAGG - Exonic
1180110263 21:45644030-45644052 GCCGCCGCAGGCGCCGGCGGCGG - Intronic
1184412115 22:44331544-44331566 CCCGCGGGAGCCGCCTGCTGGGG + Intergenic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
961012937 3:123448189-123448211 GTCGCGGCAGCCGCCGGCAGCGG - Exonic
961649324 3:128409652-128409674 TCCGCGGCTGCTGCAGGCTGCGG + Intergenic
976367205 4:84245144-84245166 GCCGCAGCTGCCGCCGGCTGAGG - Intergenic
983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG + Intronic
992269824 5:75053161-75053183 CCCGCGGCAGCCGCCGCCTGCGG - Intergenic
1019540223 7:1547969-1547991 TCCCCTGCAGACCCCGTCTGGGG - Intronic
1021845269 7:24757368-24757390 TGCGCGGCGGGCGCGGGCTGCGG - Intronic
1022048627 7:26643713-26643735 TCTGCAGCAGACACCAGCTGAGG - Intronic
1022106271 7:27199881-27199903 GCCGCCGCAGCCGCCGGGTGGGG + Exonic
1022107179 7:27204983-27205005 GCCGCGGCTGCCGCCGGCTTCGG - Intergenic
1027228195 7:76258036-76258058 TCTGTGGCAGAGGCTGGCTGGGG + Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1049828311 8:144684807-144684829 TCTGCGGCAGGCGCGGGCTGGGG - Intergenic
1049835990 8:144735910-144735932 TGCTCGGCAGTCGCCTGCTGAGG + Intronic
1056132777 9:83602112-83602134 TGCGCTGCAGACGCTGGATGGGG - Intergenic
1057490424 9:95516169-95516191 GCCGCGGCGGGCCCCGGCTGAGG - Intronic
1058412327 9:104747679-104747701 TCATTGGCAGACGCAGGCTGGGG - Exonic
1062387106 9:136317026-136317048 TCGGCGGCAGGCCCAGGCTGAGG + Intergenic
1187332581 X:18354396-18354418 TCCGCGGAAGGCGCCGGGGGCGG + Intronic
1189310021 X:40012423-40012445 TCCGCGGCAGCTGCGGGCAGAGG - Intergenic