ID: 1145816456

View in Genome Browser
Species Human (GRCh38)
Location 17:27798410-27798432
Sequence GAGCTTGGCCTGAGAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145816456_1145816467 18 Left 1145816456 17:27798410-27798432 CCTCCCATTCTCAGGCCAAGCTC 0: 1
1: 0
2: 3
3: 18
4: 303
Right 1145816467 17:27798451-27798473 AAAGATTCCAAGCTTCTTCAGGG 0: 1
1: 0
2: 1
3: 22
4: 208
1145816456_1145816466 17 Left 1145816456 17:27798410-27798432 CCTCCCATTCTCAGGCCAAGCTC 0: 1
1: 0
2: 3
3: 18
4: 303
Right 1145816466 17:27798450-27798472 CAAAGATTCCAAGCTTCTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145816456 Original CRISPR GAGCTTGGCCTGAGAATGGG AGG (reversed) Intronic
900209412 1:1446511-1446533 GAGGATCGCCTGAGCATGGGAGG + Intergenic
900213643 1:1469360-1469382 GAGGATCGCCTGAGCATGGGAGG + Exonic
900219231 1:1498373-1498395 GAGGATCGCCTGAGCATGGGAGG + Intergenic
900221203 1:1510161-1510183 GAGGATCGCCTGAGCATGGGAGG + Intergenic
900437011 1:2635561-2635583 TAGCCTGGCCTGAGAGTGTGGGG - Intergenic
900473915 1:2867554-2867576 GAGCTAATCCTGAGCATGGGTGG + Intergenic
900721300 1:4177519-4177541 GAGCTGGGCCTGAGAATGGAGGG - Intergenic
900808860 1:4786041-4786063 GAGTTTGGCGTGAGAAAGGCAGG + Exonic
900965956 1:5958767-5958789 GAGATTGACTTGAGCATGGGAGG + Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902261433 1:15227670-15227692 GATGTTGGGCTGAGAATGGATGG - Intergenic
902296341 1:15469787-15469809 GAGCCTGGCCTGAGACTGACTGG + Intronic
902299133 1:15489059-15489081 GAGCCTGGCCTGAGACTGACTGG + Intronic
902703784 1:18190846-18190868 GATCTTGGCCTGTGATTGAGGGG + Intronic
903161607 1:21493001-21493023 GAGATTGGCTTGAGCCTGGGAGG + Intergenic
903793098 1:25907494-25907516 GGTCTTGGTCAGAGAATGGGAGG - Intergenic
904262995 1:29301123-29301145 GAGATTGGCTTGAAAATGTGGGG + Intronic
905334955 1:37238832-37238854 AAGGTTGTCCTGAGAATGTGAGG + Intergenic
905796135 1:40817734-40817756 GATTTTGTCCTGAGAAGGGGTGG - Intronic
907173094 1:52490238-52490260 GAGGATGGCCTGAGCCTGGGAGG - Intronic
908064801 1:60391249-60391271 GAACTTGGGCTGAGAATAGTTGG - Intergenic
908686058 1:66721496-66721518 GAGAATTGCCTGAGACTGGGAGG - Intronic
909577572 1:77191909-77191931 GAATTTGGCCTGAGCATGAGTGG - Intronic
910527611 1:88198697-88198719 GACCTTCCCCTGAGAATGAGAGG - Intergenic
911135145 1:94431291-94431313 TAGCTTGGCCTGAGATAGGCAGG + Intronic
912468844 1:109892788-109892810 GAGATTTGCCTCAGGATGGGAGG - Intergenic
912699497 1:111866352-111866374 GAGGTTGGCTTGAGCCTGGGAGG - Intronic
915074752 1:153298902-153298924 GAGCTGGGCATGGGGATGGGTGG + Intronic
915105983 1:153535457-153535479 GTGTGTGGCCTGAGACTGGGTGG - Intronic
915240374 1:154516855-154516877 GAGGTTGGCTTGAGCCTGGGAGG + Intronic
917958555 1:180124952-180124974 GAGCGTGGACTGAATATGGGTGG + Intergenic
917989341 1:180356758-180356780 GAGGATGGCTTGAGCATGGGCGG + Intronic
920351334 1:205339882-205339904 AAGCTTGGCCTGGCCATGGGAGG - Intronic
920684066 1:208095768-208095790 TATCTTGGCCTGAGAGTTGGGGG + Intronic
923625213 1:235608025-235608047 GAGAATGGCCTGAGCCTGGGAGG - Intronic
1063688198 10:8258477-8258499 GAGTTAGCCCTGAGGATGGGAGG - Intergenic
1064598765 10:16972525-16972547 GAGGATGGCTTGAGCATGGGAGG - Intronic
1064730482 10:18325832-18325854 GAGGTTGGCTTGAGTCTGGGAGG - Intronic
1065624138 10:27613501-27613523 GAGCCTGGCCTGAGAAAGGGAGG - Intergenic
1065774969 10:29111063-29111085 GAGCTTGGCCAGAGAAAGCCAGG - Intergenic
1065993016 10:31031554-31031576 GAGCGAGGCCTTAGAAGGGGCGG - Intronic
1066586601 10:36943284-36943306 GAGAATGGCGTGAAAATGGGAGG + Intergenic
1067735253 10:48845503-48845525 GAGCTTGATCTGAGACTTGGAGG + Intronic
1068078474 10:52288726-52288748 GATCTGGGCCTGAGAAAGGTGGG - Exonic
1068966722 10:62919186-62919208 AAGCTTGGCCTGAGAACAGACGG + Intronic
1070209644 10:74302704-74302726 GAGGTTGGCTTGAGCCTGGGAGG + Intronic
1071235049 10:83635602-83635624 GAGTTTGGCCTAAGAGTAGGTGG - Intergenic
1072255317 10:93615200-93615222 GAGGATGGCCTGAGTCTGGGAGG + Intronic
1075719036 10:124574427-124574449 GAGCCTGGCTCGAGGATGGGCGG + Intronic
1077515285 11:2998008-2998030 GAGGATTGCCTGAGCATGGGAGG - Intergenic
1077524851 11:3057780-3057802 GAGCAGGGCCTGGGGATGGGCGG + Intergenic
1077880008 11:6341486-6341508 GAGGATGGCCTGAGACTGGGAGG + Intergenic
1078089693 11:8257257-8257279 GAGCTAAGCCTGGAAATGGGAGG + Intronic
1081937759 11:46917245-46917267 GAGCTGGGGCTCAGAATGGAGGG - Intronic
1083421511 11:62555954-62555976 GAGCCTGGAGTGTGAATGGGAGG - Intronic
1083604957 11:63972933-63972955 GAGGTTGGCTTGAGTCTGGGAGG + Intergenic
1084095027 11:66905748-66905770 GAGCTTGGCCTCAGCAAGGTGGG + Intronic
1084225731 11:67713712-67713734 GAGACTGGCTTGAGAAGGGGTGG + Intergenic
1084437974 11:69155196-69155218 GAGTTTCCCCCGAGAATGGGAGG + Intergenic
1086333717 11:85778886-85778908 GAGAATGGCTTGAGACTGGGAGG + Intronic
1087771407 11:102213986-102214008 GAGGATGGCCTGAGTCTGGGAGG + Intronic
1089454095 11:118615824-118615846 AAACTCTGCCTGAGAATGGGAGG - Intronic
1090129071 11:124120594-124120616 GAGCTTGCCCTGAGGAAGAGTGG - Intronic
1090736938 11:129618357-129618379 GTGCTTGGCTAGAGAAAGGGCGG + Intergenic
1096298445 12:50404463-50404485 GAGTTTCGCTTGAGTATGGGAGG + Intronic
1096299526 12:50414391-50414413 GAGGATGGCTTGAGAATGGGAGG - Intronic
1096674830 12:53220903-53220925 GAGCCAGGCCTGGGAATGAGAGG - Intronic
1096909081 12:54963815-54963837 GCCCTTGGCCTGAGAGGGGGTGG + Exonic
1099658398 12:85524569-85524591 CTACTTGGCCTGAGAAAGGGAGG - Intergenic
1101675469 12:106913111-106913133 GACCTGGGCCTCAGAAGGGGTGG + Intergenic
1102468127 12:113142491-113142513 GGTCTTGGCCTCAGAATGGAAGG - Intergenic
1105417346 13:20224891-20224913 GGGGCTGGCCTGAGAAGGGGAGG - Intronic
1105995167 13:25664117-25664139 GAGGATGGCCTGAGTCTGGGAGG + Intronic
1106194918 13:27484699-27484721 GAGAATGGCCTGAACATGGGAGG + Intergenic
1110193880 13:72763209-72763231 GAGGATGGCTTGAGACTGGGTGG + Intronic
1110907270 13:80907519-80907541 GAGGATGGCTTGAGCATGGGAGG - Intergenic
1112493553 13:99887661-99887683 GAGGATGGCCTGAGCCTGGGAGG + Intronic
1113483900 13:110640904-110640926 GAGCTGGGCCTGGGAAAGGTTGG - Intergenic
1114557669 14:23571231-23571253 AAGCTTGGCCTGAGGAGTGGGGG - Exonic
1115430461 14:33311795-33311817 TAACTTGGCCTGAGAATGACAGG + Intronic
1118034216 14:61849109-61849131 GAACTAGGCCCTAGAATGGGGGG + Intergenic
1118883538 14:69848726-69848748 GAGCTGGGCCTGAGGTTGGAAGG + Intergenic
1119500485 14:75122886-75122908 GAGGATGGCTTGAGACTGGGAGG - Intronic
1120624108 14:86803411-86803433 GAGATTGGCATGTGAGTGGGTGG + Intergenic
1121083439 14:91127144-91127166 GAGGATGGCTTGAGATTGGGAGG - Intronic
1122077217 14:99243881-99243903 GAGATTTGCCTGGAAATGGGGGG - Intronic
1123116854 14:105898823-105898845 GGGCTTGGCCTGAGAGGGGGCGG + Intergenic
1123898589 15:24852843-24852865 GAGGGTGGCCTGAGCTTGGGAGG + Intronic
1124199590 15:27667093-27667115 AAGCTTGGACTGAGAGTAGGAGG - Intergenic
1125519093 15:40338380-40338402 GAGACTGGCCAGAGAAAGGGAGG + Intronic
1127123160 15:55788314-55788336 GAGGATGGCTTGAGCATGGGGGG + Intergenic
1128559067 15:68652582-68652604 CAGCTGGGACTGAGAATGGCTGG - Intronic
1129523741 15:76201313-76201335 CAGAGTGGCCTGAGAGTGGGAGG - Intronic
1130728134 15:86462325-86462347 GAGCTTGGGCTGAGACTGGAAGG - Intronic
1130950510 15:88583202-88583224 GAGGTTGGCTTGAGCCTGGGAGG + Intergenic
1131142752 15:89990906-89990928 GAGCATGGCTTGAGCCTGGGAGG - Intergenic
1132366078 15:101257946-101257968 GAGGTTGGCTTGAGCCTGGGAGG - Intergenic
1132664943 16:1077270-1077292 GACCTCGGCCTGAGCAGGGGTGG - Intergenic
1132797521 16:1732595-1732617 GGACTTGCCCTGAGAACGGGCGG + Intronic
1132797557 16:1732755-1732777 CAGCTTGCCCCGAGAACGGGTGG + Intronic
1133284648 16:4684926-4684948 GACCTGGGCCTGACATTGGGTGG + Intronic
1135283924 16:21176808-21176830 GAGGATGGCCTGAGCCTGGGAGG + Intronic
1135575005 16:23578917-23578939 GAGGATGGCCTGAGCCTGGGAGG + Intergenic
1136418927 16:30120392-30120414 GGGCTGGGACTGAGAGTGGGTGG + Intronic
1136564747 16:31063220-31063242 GAGGATGGCCTGAGCCTGGGAGG - Intronic
1136589362 16:31208177-31208199 GAGCCTGGGCTGAGAACTGGAGG - Intergenic
1137236608 16:46623369-46623391 GAGCTTAGCCTGCCAAGGGGAGG + Intergenic
1137666885 16:50255582-50255604 GGGCATGGCTTGAGCATGGGAGG - Intronic
1137975320 16:53026380-53026402 GAGGATGGCTTGAGCATGGGAGG - Intergenic
1138512535 16:57516829-57516851 GAGCTAGGCTGGGGAATGGGTGG + Intronic
1139397895 16:66655071-66655093 GAGGTTGGCTTGAGCCTGGGTGG - Intronic
1139697813 16:68687668-68687690 GAGCTGGGCCTGGAAAGGGGAGG - Exonic
1140073900 16:71678548-71678570 GAGAATCGCCTGAGAACGGGAGG + Intronic
1140488623 16:75315240-75315262 GAGGTTTGCTTGAGAACGGGAGG + Intronic
1142804360 17:2363688-2363710 GAGCTTGACCAGAGACGGGGGGG + Intronic
1143584949 17:7846386-7846408 GAGCTGGGCCTGGGGGTGGGGGG - Exonic
1143721828 17:8817836-8817858 GAGCTTGACTTGAGAAGGGAAGG + Intronic
1144846247 17:18221164-18221186 GAGATTGACCTGAGGCTGGGAGG + Intergenic
1145816456 17:27798410-27798432 GAGCTTGGCCTGAGAATGGGAGG - Intronic
1146435495 17:32842222-32842244 GAGCTTGGACTGAGAGTTGTGGG + Intronic
1147299583 17:39514889-39514911 GTGGTTTGCCTGGGAATGGGAGG - Intronic
1147327365 17:39675916-39675938 AAGCTTGGGCTGAGAAGGGCAGG - Intronic
1147414408 17:40278208-40278230 AGGCTTCACCTGAGAATGGGTGG - Exonic
1147656424 17:42093668-42093690 GAGATTTGCCTGAGCCTGGGAGG - Intergenic
1148563959 17:48622236-48622258 GCCCTTGGCCTGAGAATAGTTGG + Exonic
1148586407 17:48784313-48784335 GAGGATGGCTTGAGCATGGGAGG + Intronic
1148860700 17:50602942-50602964 CAGCTTGGGCTGAGGGTGGGAGG + Intronic
1149876174 17:60235195-60235217 TAGCTTGGCCTTAGAATGAGTGG - Intronic
1149904259 17:60510624-60510646 GAGGTTTGCCTGAGCCTGGGAGG + Intronic
1150933544 17:69611196-69611218 GAGGTTGGCTTGAGCCTGGGAGG - Intergenic
1151634078 17:75332059-75332081 GAGCAGGGCCTGTGAATGAGGGG + Intronic
1151641699 17:75400085-75400107 GAGGATGGCCTGAGCCTGGGAGG - Intronic
1151886144 17:76924336-76924358 CAGCTTGGCCAGAGGAGGGGTGG - Intronic
1152011493 17:77721644-77721666 GAGCTTTGGCTGAGAGGGGGAGG - Intergenic
1152018790 17:77769635-77769657 GAGCATGGCCTGAGACTTGGAGG + Intergenic
1152366159 17:79857772-79857794 GACCTGGCCCTGAGAATGTGGGG + Intergenic
1152474556 17:80509519-80509541 GAGGATCGCTTGAGAATGGGAGG - Intergenic
1152882469 17:82826863-82826885 GAGGATGGCCTGAGCCTGGGAGG - Intronic
1152892424 17:82890196-82890218 CAGCTTCGCCTGTGAATGGGGGG + Intronic
1153807035 18:8717716-8717738 GGGCTTGGCTGTAGAATGGGAGG + Intronic
1153835332 18:8958985-8959007 GAGCTTGGACTGAGAACGGTGGG + Intergenic
1154010832 18:10572430-10572452 AAGCTGGGCCTGAGGATGGAGGG + Intergenic
1157770610 18:50342041-50342063 GAGGTAGGCCTGAGAAGGTGAGG - Intergenic
1157833964 18:50882086-50882108 GAGGATGGCTTGAGCATGGGAGG - Intronic
1158069405 18:53453003-53453025 GAGAATGGCATGAAAATGGGAGG - Intronic
1158231199 18:55257266-55257288 GAACATGACCTGAAAATGGGTGG + Intronic
1158718847 18:59905282-59905304 GAGCTTGGCTTCAGAAAGGGTGG + Intergenic
1159955013 18:74512979-74513001 GTGCTTGGCCTGAGAGCAGGAGG - Intronic
1160253705 18:77228087-77228109 GAGCTTGGCCAGTGCATGTGAGG + Intergenic
1160375102 18:78405766-78405788 AACCCTGGCCTGAGAACGGGAGG - Intergenic
1160395245 18:78566159-78566181 GACCCTGGCCTGAGAATGAATGG + Intergenic
1160924305 19:1535783-1535805 GAGGATGGCGTGAGCATGGGAGG + Intergenic
1160946428 19:1646043-1646065 GAGCTGGGCCTGTGTGTGGGTGG - Intronic
1161221041 19:3118351-3118373 GTGCGTGGCCTGAGAGTGTGAGG + Intronic
1163446100 19:17347407-17347429 GAGCTGGGCCTGTGCCTGGGTGG + Intergenic
1164724659 19:30457974-30457996 GGGCTTGCTATGAGAATGGGTGG + Intronic
1164919595 19:32078979-32079001 GAGCTGAGCCTGAGGATGGGTGG - Intergenic
1165043161 19:33083152-33083174 GAGAATGGCGTGAGACTGGGAGG + Intronic
1165493978 19:36141242-36141264 GGGCGGGGCCTGGGAATGGGAGG + Intronic
1166052928 19:40271335-40271357 GAGGTTGACCTGAGCCTGGGAGG + Intronic
1166085810 19:40474060-40474082 GAGGATGGCCTGAGACTGTGAGG + Intronic
1166917330 19:46204305-46204327 GAGCTGGGCCTGGGACTGGGGGG + Intergenic
1167774372 19:51545082-51545104 GTTCTGGGCCTGTGAATGGGAGG - Intergenic
927100880 2:19787000-19787022 GAGCTGGGCCTGAGTAGGTGTGG - Intergenic
927311952 2:21641496-21641518 GAGCTTGGCCTGTGCTTGGCAGG + Intergenic
928338268 2:30417600-30417622 GAGCTGGGGATGAGGATGGGAGG + Intergenic
928771275 2:34704665-34704687 GAGAATGGCCTGAGCCTGGGAGG - Intergenic
928786088 2:34887802-34887824 GAGCTAGGGCTTGGAATGGGGGG + Intergenic
931728711 2:65134229-65134251 CAGCTTAGCCTGGGAATGGTAGG + Intergenic
932510248 2:72279701-72279723 GAGCATGGCTTGAGCCTGGGAGG - Intronic
933660051 2:84920285-84920307 GAGATTGGCATGTGAGTGGGTGG + Intergenic
935254929 2:101301415-101301437 GAGGTTCGCCTGAGCCTGGGAGG - Intronic
935967389 2:108494282-108494304 GAGGATGGCCTGAGCCTGGGAGG + Intronic
936131031 2:109842423-109842445 GAGGATGGCCTGAGCCTGGGAGG + Intronic
936213666 2:110529062-110529084 GAGGATGGCCTGAGCCTGGGAGG - Intronic
936422804 2:112383622-112383644 GAGGATGGCCTGAGCCTGGGAGG - Intronic
936427945 2:112435578-112435600 CAGCGTGGCCTGAGCAAGGGAGG - Intergenic
937361096 2:121230681-121230703 GAGGATGGCCTGAGCCTGGGAGG + Intronic
940285836 2:152032253-152032275 GAAATTGGCCTGAGAAGGGAAGG + Intronic
941401472 2:165036129-165036151 GAGCTTGGCCTCAGCACAGGTGG - Intergenic
941936644 2:170986935-170986957 GGGGTGGGCCTGAGAATGGTTGG - Intergenic
942886331 2:180928641-180928663 GATCTGAGCCTGGGAATGGGAGG + Intergenic
943305680 2:186258778-186258800 GAGGATGGCCTGAGATCGGGAGG + Intergenic
944414485 2:199468774-199468796 GAGCTTGGCCTGAGGGGCGGGGG - Intronic
944723262 2:202445314-202445336 GAGGATGGCTTGAGACTGGGAGG - Intronic
945103852 2:206289520-206289542 TAGCTTGGCCTGGGGATGTGAGG + Intronic
946918492 2:224551743-224551765 GAGCTGTGCCTGAGAATGTATGG + Intronic
947671599 2:231940155-231940177 GAGGCTGGCTTGAGATTGGGAGG + Intergenic
1169009338 20:2237360-2237382 GAGCCTGGAGTGAGAGTGGGTGG - Intergenic
1172538808 20:35695306-35695328 GACCTTGGCCTGAATATAGGAGG - Intronic
1173392914 20:42650948-42650970 GAGCTTCGCCAGAGAAATGGAGG - Intronic
1173462697 20:43256658-43256680 GAGGTTTGCCTGAGCCTGGGAGG - Intergenic
1174394684 20:50239670-50239692 GAGCTGGGCCTGGGAATAGCTGG + Intergenic
1174717271 20:52773208-52773230 GAGGATTGCCTGAGACTGGGAGG - Intergenic
1174826028 20:53769660-53769682 GAGGATGGCTTGAGACTGGGAGG - Intergenic
1175097687 20:56554454-56554476 GAGAATGGCTTGAGCATGGGAGG + Intergenic
1175552948 20:59828777-59828799 GAGTTTGTCCTGAGGATGGTGGG + Intronic
1176298004 21:5084666-5084688 GAGCTGGGGCTGAGGCTGGGAGG - Intergenic
1179310441 21:40191037-40191059 GAGCTTGACCTCAGAAATGGGGG - Intronic
1179859025 21:44177283-44177305 GAGCTGGGGCTGAGGCTGGGAGG + Intergenic
1180917394 22:19498785-19498807 GAGCATGGCCTAGGAGTGGGTGG + Intronic
1181319006 22:21990487-21990509 GAGCTGGGCCTGAGTCTGGCAGG - Intergenic
1182522196 22:30891005-30891027 CAGCTTGGCCAGAGTGTGGGTGG - Intronic
1184977481 22:48073011-48073033 GAGATTTGCATGTGAATGGGTGG - Intergenic
1185272674 22:49936024-49936046 GGGCCTGGGCTGAGCATGGGAGG + Intergenic
949927074 3:9049861-9049883 GAGCATGGCTTGAGCCTGGGAGG - Intronic
950971773 3:17196332-17196354 GTGCTTGGGCTGAGACTGGAAGG + Intronic
951043158 3:18010594-18010616 GAGCTGGGCATGAGAAGGGCAGG - Intronic
951060011 3:18194985-18195007 GAGTTTAGCCTTTGAATGGGTGG + Intronic
951221954 3:20078087-20078109 GAGGATGGCCTGAGCCTGGGAGG + Intronic
952389209 3:32865427-32865449 CAGTGTGGCCTGAGAAAGGGTGG - Intronic
954650500 3:52158952-52158974 GAGCATGGCGTGAAACTGGGAGG - Intergenic
955399331 3:58580079-58580101 GAGTGTGGCCTGGGAAAGGGTGG - Intronic
955798478 3:62662147-62662169 GAGCTTGCCTTGAGAAAGGAGGG + Intronic
956796697 3:72724468-72724490 GAGCTGGGCTTGAAACTGGGAGG - Intergenic
958262347 3:91396152-91396174 GAGCTTCGCTTGAGTAGGGGAGG + Intergenic
961255761 3:125550283-125550305 GAGGATGGCCTGAGCCTGGGAGG + Intronic
961749728 3:129088067-129088089 GAGCTTAGCCTGCCAAGGGGAGG + Exonic
963609879 3:147453744-147453766 GAGGATGGCTTGAGCATGGGAGG - Intronic
963880779 3:150525817-150525839 GAGGATGGCCTGAGCCTGGGAGG + Intergenic
963921966 3:150914410-150914432 GAGCTTGCCCTGAGAGCTGGGGG + Intronic
964101084 3:152989427-152989449 GCGCTTTGCCTCTGAATGGGCGG + Intergenic
965751246 3:171976945-171976967 GAGCCTTGCTTGTGAATGGGAGG - Intergenic
966670581 3:182521696-182521718 CAGTTTGGCAGGAGAATGGGGGG + Intergenic
966911973 3:184564788-184564810 GGGCTTGGCATGTGGATGGGTGG + Intronic
968762384 4:2449426-2449448 GAGCTTGGCCTGGGATGGGGTGG - Intronic
968881724 4:3303581-3303603 GAGCTTGCCCTGGTAGTGGGGGG + Intronic
968997421 4:3954771-3954793 GCGCCTGTGCTGAGAATGGGAGG + Intergenic
969670759 4:8588954-8588976 GAGGATGGCTTGAGCATGGGAGG - Intronic
969869246 4:10094528-10094550 GACCGTGGCCTGAAAAAGGGAGG - Intronic
970806143 4:20035634-20035656 GAGGATGGCCTGAGCCTGGGTGG + Intergenic
971098432 4:23435003-23435025 GAGCATTGCCTGAGGCTGGGGGG - Intergenic
974378650 4:61109340-61109362 GAGATTGGCCTGTGAGTTGGTGG + Intergenic
974583724 4:63841333-63841355 GAGCTGGGAAGGAGAATGGGTGG - Intergenic
974902765 4:68021669-68021691 GAGGATGGCTTGAGCATGGGAGG - Intergenic
976019509 4:80604111-80604133 GAGCTTGGCCTAGGGAAGGGAGG + Intronic
976339060 4:83924966-83924988 GAGGATGGCCTGAGCCTGGGAGG + Intergenic
977574108 4:98658819-98658841 GGGGTTGGCCCGAGAAGGGGCGG - Intergenic
979600013 4:122577175-122577197 GAGTTTGGCATGAGAATGTTGGG + Intergenic
980620193 4:135291392-135291414 GAGTTTTGCTTGAGTATGGGAGG - Intergenic
981057812 4:140383722-140383744 GAGCTTGGCCTTAAAATGATGGG - Exonic
985523366 5:389547-389569 GAGCTTTTCCACAGAATGGGGGG - Intronic
985629562 5:1007637-1007659 GAGGATGGTCTGAGAATGGGAGG + Intergenic
985678951 5:1246119-1246141 GGGCTTGGCCTGATGGTGGGCGG + Exonic
988727036 5:33936468-33936490 GAGCTTGGCCTGAGAACCCTTGG + Exonic
988986310 5:36622224-36622246 GTGGTTGGCCTCAGAATGCGAGG + Intronic
989502992 5:42190853-42190875 GAGCATTGCTTGAGACTGGGAGG + Intergenic
990264137 5:54057757-54057779 GAGGATGGCCTGAGTCTGGGAGG + Intronic
990645053 5:57834552-57834574 GAGAATGGCCTGAGCCTGGGAGG + Intergenic
992497233 5:77305709-77305731 AAGTTTGGCCTGAGAATGGAGGG + Intronic
995006303 5:107200081-107200103 GAGCTGGGCCTTGGAATGGAAGG + Intergenic
995557506 5:113344636-113344658 AAGCTAGACCTTAGAATGGGGGG - Intronic
996126704 5:119734238-119734260 GAGATTGGCCTGTGAATTGGTGG + Intergenic
996161584 5:120173550-120173572 GAGCTAGGGCCTAGAATGGGGGG - Intergenic
997814166 5:136999999-137000021 GAGGTTTGCCTGAGAGAGGGGGG - Intronic
998000926 5:138625104-138625126 GAGGATCGCTTGAGAATGGGAGG + Intronic
999196369 5:149784290-149784312 GAGCGTGGCCTCTGAGTGGGAGG - Intronic
1000107202 5:158071324-158071346 GCTCATGGACTGAGAATGGGAGG + Intergenic
1000415259 5:160977484-160977506 TACCTTGGCCTGAGAATATGGGG + Intergenic
1000580171 5:163026556-163026578 GAGATTGGCCTGTGAATCAGTGG - Intergenic
1002132070 5:177087661-177087683 CAGCTTGGGCTGGGAGTGGGTGG - Intronic
1003171122 6:3722937-3722959 GAGCTTGGACTGAGCGTTGGTGG - Exonic
1003279832 6:4681590-4681612 GAAAGTGGCCTGAGAAAGGGTGG - Intergenic
1004713240 6:18192170-18192192 GAGGATGGCCTGAGCTTGGGAGG + Intronic
1006065905 6:31462669-31462691 GAGCTTCTCCTGGGAATGGAGGG - Intergenic
1006301071 6:33193716-33193738 GATCCTGGCCTGAGAATTGAGGG - Exonic
1006321077 6:33319876-33319898 GAGGGTAGCCTGAGAATGAGGGG + Intronic
1006374955 6:33666952-33666974 GAGCTGGGGCTGAGGATGGCTGG + Intronic
1008528794 6:52434949-52434971 GAAGTTGGCCTGAGAATGGGAGG - Intronic
1011296152 6:85828005-85828027 GAGATTTGCTTGAGACTGGGAGG + Intergenic
1013545551 6:111153443-111153465 GAGGTTGGCTTGAGCCTGGGAGG + Intronic
1017454830 6:154592117-154592139 GAGGATGGCTTGAGACTGGGAGG + Intergenic
1017969583 6:159299871-159299893 GGACCTGGCCTGAGACTGGGTGG - Intergenic
1019410407 7:904264-904286 CTCCTTGGCCTGAGAAGGGGTGG + Exonic
1019956408 7:4418213-4418235 GCAATTGGCCTGTGAATGGGTGG + Intergenic
1021928723 7:25558384-25558406 GAGCTGGGCCTGTGCATAGGAGG - Intergenic
1022019078 7:26381063-26381085 GAGGATGGCTTGAGACTGGGAGG - Intergenic
1023011007 7:35924892-35924914 GCGCCTGGCCAGAGAAGGGGAGG - Intergenic
1023809735 7:43902416-43902438 GAGCTCGGACACAGAATGGGTGG - Intronic
1024080120 7:45848951-45848973 GCGCCTGGCCAGAGAAGGGGAGG + Intergenic
1024836511 7:53526063-53526085 GAGAATGGCCTGAAACTGGGAGG - Intergenic
1025129870 7:56369623-56369645 GAGCTTGGCTTGAGAAAGTTCGG + Intergenic
1028928425 7:96386133-96386155 GAGCTTTGCCTGTGCCTGGGAGG + Intergenic
1029088412 7:98029406-98029428 GAGAATGGCCTGAGCCTGGGAGG - Intergenic
1029555273 7:101264574-101264596 GTGCCTGGCCAGAGAAGGGGAGG - Intergenic
1031596737 7:123657898-123657920 GAGGTTGGCTTCAGCATGGGAGG + Intronic
1034202816 7:149293183-149293205 GAGCTTGGTCTGTGAATGACGGG - Intronic
1035313535 7:157984350-157984372 GAGCCTGGCGTGGGATTGGGTGG - Intronic
1035847686 8:2882759-2882781 GAGACTGGCCTGTGAGTGGGTGG + Intergenic
1037734421 8:21555268-21555290 GAGCTTGGGCTGACCCTGGGAGG - Intergenic
1039257637 8:35736279-35736301 GAGGATGGCTTGAGCATGGGAGG + Intronic
1040691229 8:49941080-49941102 GAGTTTGTCCTGAGAAGAGGGGG - Intronic
1042909152 8:73806620-73806642 GAGAATGGCGTGAGACTGGGAGG + Intronic
1043919585 8:85965789-85965811 AAGCTTGGCCTGGGAAACGGTGG + Intergenic
1045115813 8:98978535-98978557 GATCTAGGCCTGTGAATGGAGGG + Intergenic
1048577157 8:135701865-135701887 CAGCTTGGCTTGGGGATGGGTGG + Intergenic
1048652004 8:136488145-136488167 CAGCTCTGCCTGAGACTGGGTGG + Intergenic
1050431033 9:5562011-5562033 GAGCTTGGCCTGGAATTTGGAGG - Intronic
1050979821 9:11996432-11996454 TAGCTTGGCTTGAGAATGTCAGG - Intergenic
1052021117 9:23526221-23526243 GTGCGTGGCCTGAAAATGGAGGG + Intergenic
1052518441 9:29512406-29512428 GAGAATGGCCTGAGCCTGGGAGG - Intergenic
1052974814 9:34402607-34402629 GAGCTGGGCCTGAGGAGGGAGGG + Intronic
1056008852 9:82303536-82303558 GATCCTGGCTGGAGAATGGGAGG + Intergenic
1058742122 9:107954231-107954253 GAGCTTGGCTTGAGAAAGAGAGG - Intergenic
1058980436 9:110164618-110164640 GAGACTCGCCTGAGCATGGGAGG - Intronic
1059326438 9:113506644-113506666 TTTCTTGGCCTGAGAATGGAAGG + Intronic
1060218363 9:121751834-121751856 GAGCTTGGCCAGGGCATGGGAGG - Intronic
1060591467 9:124819751-124819773 GAGCATAGCCTGAGCATGGGAGG - Intergenic
1060820634 9:126659488-126659510 GCCCCTGGCCTGAGAATGTGTGG - Intronic
1060954361 9:127627904-127627926 GAGCATGGCTTGAGCCTGGGAGG - Intronic
1061059875 9:128245006-128245028 GAGCTGGGGCTGAGAAGGAGGGG + Intronic
1061788888 9:133048037-133048059 GAGGATGGCCTGAGCCTGGGAGG + Intronic
1062602816 9:137326434-137326456 GAGGATGGCCTGAGCCTGGGAGG + Intronic
1186781322 X:12915250-12915272 GAGAATCGCCTGAGACTGGGAGG - Intronic
1189528970 X:41858433-41858455 GACCTATTCCTGAGAATGGGAGG + Intronic
1190078243 X:47334683-47334705 GAGGAAGGCCTGAGACTGGGAGG + Intergenic
1190263452 X:48814098-48814120 GAGCTGAGCCTGAAATTGGGTGG + Intronic
1192453975 X:71262325-71262347 GAGGATGGCTTGAGCATGGGAGG - Intergenic
1193531151 X:82656169-82656191 GAGATTGGCTTGTGAATTGGTGG - Intergenic
1193651386 X:84138461-84138483 GAGGATTGCCTGAGCATGGGAGG + Intronic
1194808984 X:98367073-98367095 GAGCTTGGTCAAAGAATGAGAGG + Intergenic
1196751716 X:119124084-119124106 GAGTTTTGCCTGAGCCTGGGAGG - Intronic
1197335084 X:125203362-125203384 GTGCTTGGGGTGAGGATGGGAGG - Intergenic
1199389890 X:147267250-147267272 GAGCATGGCTTGAGCCTGGGAGG + Intergenic
1201286225 Y:12381074-12381096 GAGGATCGCCTGAGACTGGGAGG - Intergenic