ID: 1145817496

View in Genome Browser
Species Human (GRCh38)
Location 17:27805979-27806001
Sequence GGGGTAGTCCCAGGGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145817487_1145817496 18 Left 1145817487 17:27805938-27805960 CCGTCCTTCTAGGCGGAGAAACA 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1145817496 17:27805979-27806001 GGGGTAGTCCCAGGGTGTGATGG 0: 1
1: 0
2: 0
3: 12
4: 160
1145817486_1145817496 19 Left 1145817486 17:27805937-27805959 CCCGTCCTTCTAGGCGGAGAAAC 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1145817496 17:27805979-27806001 GGGGTAGTCCCAGGGTGTGATGG 0: 1
1: 0
2: 0
3: 12
4: 160
1145817488_1145817496 14 Left 1145817488 17:27805942-27805964 CCTTCTAGGCGGAGAAACAACAA 0: 1
1: 0
2: 2
3: 5
4: 127
Right 1145817496 17:27805979-27806001 GGGGTAGTCCCAGGGTGTGATGG 0: 1
1: 0
2: 0
3: 12
4: 160
1145817484_1145817496 27 Left 1145817484 17:27805929-27805951 CCTGGGTGCCCGTCCTTCTAGGC 0: 1
1: 0
2: 0
3: 3
4: 102
Right 1145817496 17:27805979-27806001 GGGGTAGTCCCAGGGTGTGATGG 0: 1
1: 0
2: 0
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145817496 Original CRISPR GGGGTAGTCCCAGGGTGTGA TGG Intronic
900109999 1:1001381-1001403 GTGGCATTCCCAGGGTGCGAAGG + Intergenic
900117814 1:1035943-1035965 GGGGTGGTGTGAGGGTGTGAGGG + Intronic
900988279 1:6085923-6085945 GGAGCGGTCCCCGGGTGTGATGG + Intronic
901311227 1:8270941-8270963 GGGGAAGCCCCAGTGTCTGAGGG + Intergenic
902777913 1:18686361-18686383 GGGATGGTCCCAGGGGGTGCTGG - Intronic
904237941 1:29125892-29125914 GGGGAAGGCCCAGGGTCTGAAGG - Intergenic
905263717 1:36736814-36736836 GAGCTAGTCCCAGAGAGTGACGG + Intergenic
906948605 1:50316541-50316563 GGGGCAGGGCCAGGTTGTGAGGG + Intergenic
907908833 1:58809568-58809590 AGGCTAGTCACACGGTGTGAGGG + Intergenic
908673413 1:66574228-66574250 GGGGTACTCCCAAGCTGAGAGGG - Intronic
908780909 1:67688803-67688825 GGATTAGGCCCAGGCTGTGAAGG + Intergenic
915600672 1:156921187-156921209 GAGGAAGGCCCAGGGGGTGAGGG + Intronic
919878155 1:201885600-201885622 GGGGTAGGACCAGGGTGGGATGG + Intergenic
923055733 1:230425325-230425347 GGGGTGCTCCCAGGAAGTGAAGG + Intronic
1064880919 10:20052777-20052799 GGGATAGTCCCAGGGCCAGAGGG + Intronic
1065600328 10:27361300-27361322 GGAATATTCCCAGGATGTGATGG + Intergenic
1065617380 10:27542108-27542130 GAGGCAGTACCAGGGTGAGAGGG + Exonic
1065780459 10:29162034-29162056 GGGCTAGTTCCATGATGTGAGGG - Intergenic
1069101667 10:64330100-64330122 GGGGCAGGGGCAGGGTGTGAGGG + Intergenic
1070595394 10:77829394-77829416 GAGGAAGTCCCTGGGTGGGAAGG - Exonic
1072465211 10:95656614-95656636 GCGGTAGTGCCAGGGGGCGAAGG - Exonic
1072727275 10:97822262-97822284 GGGGTAGTCCCTGGTGGTGCTGG + Intergenic
1073124627 10:101141646-101141668 GGGTGAGTTCCAGGGAGTGATGG + Intergenic
1073599693 10:104834575-104834597 GGGGTGGTTCCAGGGTGGGCTGG - Intronic
1077139642 11:1018473-1018495 AGTGTGGTCTCAGGGTGTGATGG + Exonic
1077229259 11:1451249-1451271 GGGGCTGTCCCAGTGTGTGTGGG + Intronic
1077486125 11:2839149-2839171 GGGGAAGCCCCAGGCTGGGATGG - Intronic
1077916816 11:6616896-6616918 GGGTGAGTCCCAGGGTGGTAAGG + Intronic
1078064134 11:8066861-8066883 AGGGTTGTCCCAGGGTGACAAGG - Intronic
1078071376 11:8113657-8113679 GGGCTAGACCCAGGGTCTGCTGG - Intronic
1084428035 11:69096198-69096220 GTGGGAGGCCCAGGGGGTGAAGG + Intergenic
1085047320 11:73361019-73361041 GGGGCAGGACCAGGGTGAGATGG + Intronic
1085428203 11:76423511-76423533 GGTGCAGTCCCAGGATGTGAGGG + Intergenic
1086558541 11:88140672-88140694 GGGGAAATACCAAGGTGTGATGG + Intronic
1089601739 11:119619971-119619993 TGGGTGGTCACAGGGTGTGGGGG + Intergenic
1091224124 11:133947352-133947374 GGGGTAGTACCAGGGAATGAAGG - Intronic
1094807486 12:34107172-34107194 GGGGGAGGCACAGGGTGGGATGG + Intergenic
1095212513 12:39510244-39510266 GGGGTGGTGCCAGGCTGAGAGGG - Intergenic
1097052276 12:56230682-56230704 GGGGTGGGGCCAGTGTGTGAAGG - Exonic
1099120631 12:78685514-78685536 AGGATTGTCCCAGGGTGGGAGGG + Intergenic
1100855017 12:98750593-98750615 GGGGGAGTCCCAGGGTTTCTAGG + Intronic
1101217751 12:102601920-102601942 GGGTTCGTCACAGTGTGTGACGG - Intergenic
1102188415 12:110967214-110967236 GAGGTAATCCCAGGAAGTGACGG - Intergenic
1103927984 12:124434198-124434220 GTGGGGGTCCCAGGGTCTGAGGG + Intronic
1104689872 12:130817934-130817956 GGGGTGGTCCCAGCCTGTGGTGG + Intronic
1105804566 13:23945721-23945743 GGGGTCAGCCCAGGGTGAGAGGG - Intergenic
1106132996 13:26954810-26954832 GGGGTTGTCACAGGGACTGAAGG - Intergenic
1106509776 13:30402848-30402870 GAGGGAAGCCCAGGGTGTGAAGG + Intergenic
1113476081 13:110582322-110582344 GGGGCAGGTCCAGGGTGTGCTGG - Intergenic
1114653959 14:24304838-24304860 GTGGCAGTCCCAGGGTCTGGGGG + Intronic
1117531663 14:56665827-56665849 GAGGCAGCCCCAGGGTATGAAGG - Intronic
1122202058 14:100128611-100128633 GGGGTAGCCCCAGTGGGTGGAGG - Exonic
1122878893 14:104681139-104681161 GGGGTGGCACCAGGCTGTGAAGG + Intergenic
1131272032 15:90953373-90953395 GGGGCAGTCCTAGGGTGTGTGGG + Intronic
1132500659 16:283313-283335 GGGCCAGGCCCAGGGTGTGGCGG - Exonic
1132618890 16:855175-855197 GGGGCAGTCCGAGGCTGTGAGGG + Intronic
1137605320 16:49783232-49783254 GGGTTAGTACCAGGCTGGGATGG + Intronic
1140480171 16:75258109-75258131 GGGGTGGGGCCAGTGTGTGATGG - Intronic
1142027847 16:87824034-87824056 GGGGTAGGGGCAGGGTGTGTGGG + Intergenic
1142220194 16:88850501-88850523 GGAGGAGTCCCAGGGCTTGAGGG + Intronic
1143028201 17:3953228-3953250 GGCGCAGGCCCAGGGTGTGGAGG + Intronic
1143432783 17:6899248-6899270 GTGGGAGTCCTAGGGTGTGCAGG + Intronic
1143513537 17:7408216-7408238 GGGGGGGTCCCAGGGAGGGAGGG + Exonic
1145817496 17:27805979-27806001 GGGGTAGTCCCAGGGTGTGATGG + Intronic
1147927371 17:43953987-43954009 GGGGGAGTCCCAGGGGGAGGGGG + Intronic
1148074677 17:44928471-44928493 GCGGGATTCCCAGGGTGTGCAGG + Exonic
1148534458 17:48427823-48427845 GAGGGAGTCACAGGATGTGAGGG - Intronic
1150158786 17:62876208-62876230 AGGGCAGGCCCAGGCTGTGAAGG - Intergenic
1150250958 17:63704267-63704289 AGGGTAAGGCCAGGGTGTGAAGG - Intronic
1151758661 17:76088684-76088706 GGGGTTCTCCCAGGGAGGGATGG + Intronic
1160715095 19:572863-572885 GGTGAAGTCCCAGGGTTTGAGGG + Intronic
1160863203 19:1246215-1246237 TGGGTTGTTCCTGGGTGTGATGG - Intergenic
1161846160 19:6713039-6713061 GGGGTAGGCCCAGTCTGAGAGGG - Intronic
1162550054 19:11353679-11353701 GGGTGAGTCCTAGGGGGTGAGGG - Intronic
1163950011 19:20575678-20575700 GGGGTATTCCCTTGATGTGATGG + Intronic
1166297219 19:41895101-41895123 GGGGGAGTTCCTGGGTCTGAGGG + Intronic
1167271728 19:48510013-48510035 GGGGCAGTACCTGAGTGTGAAGG + Exonic
1167483599 19:49747355-49747377 GGGGCAGTCCCAGGATTTGTGGG - Intronic
1168634917 19:57988741-57988763 GGGGTGGTCACAGGCTGAGAAGG - Intronic
929751415 2:44717974-44717996 GGGGCAGACCCAGGTTGTGTGGG + Intronic
931215690 2:60242086-60242108 GTGTTAGTCCCAGAGTCTGAAGG - Intergenic
933112529 2:78421682-78421704 GGAGTAGTCCCGGGGGGTAAAGG - Intergenic
938201834 2:129378405-129378427 GCGGCAGAGCCAGGGTGTGAAGG - Intergenic
938340247 2:130531368-130531390 GGGGCAGCCCCAGGGTGGGCCGG + Intergenic
938349589 2:130589380-130589402 GGGGCAGCCCCAGGGTGGGCCGG - Intergenic
942833864 2:180268775-180268797 GGGAAAGTCCAAGGGTTTGATGG + Intergenic
944448714 2:199819217-199819239 GGGTGTGTCCTAGGGTGTGATGG - Exonic
945483756 2:210370521-210370543 GGGGTAGTGACAGGGTGGGTAGG + Intergenic
947536160 2:230941531-230941553 GTGGTGGTCCCAGGGAGGGAAGG - Intronic
947825647 2:233104557-233104579 GGGGTAGGCTCAGGGAGGGATGG + Intronic
948395238 2:237640533-237640555 GGGGTGGTCCTGGGGGGTGAAGG - Intronic
1173518053 20:43679001-43679023 TGGGGAGTCCCAGGGTGGGTGGG + Intronic
1174302698 20:49593845-49593867 GGGGTGGTCACAGGGAGGGAGGG - Intergenic
1175372223 20:58499696-58499718 GGGGTGGAAGCAGGGTGTGAAGG - Intronic
1178758366 21:35375594-35375616 GAGGTCATCCCTGGGTGTGAAGG - Intronic
1179373060 21:40824782-40824804 AGGGAAGTCCCCGGGTGTGGAGG - Intronic
1180008439 21:45034090-45034112 TTGGTGTTCCCAGGGTGTGAGGG + Intergenic
1180357525 22:11854851-11854873 GAGGTACTTCCAGGGTGTCAAGG + Intergenic
1180829207 22:18890480-18890502 GGTGTAGTCCCAGTGTGAGTTGG - Intergenic
1182116977 22:27762144-27762166 GGAGTGGCCCCAGGGTGTGCAGG - Intronic
1184514848 22:44955648-44955670 GGGTAAGTCCCAGAGTCTGAAGG - Intronic
1185044354 22:48521728-48521750 GGGGCAGTTCCAGGTGGTGATGG - Intronic
1203279299 22_KI270734v1_random:116518-116540 GGTGTAGTCCCAGTGTGAGTTGG - Intergenic
949537363 3:5006281-5006303 GGGGTAGCCTCTGGGTGTGCGGG - Intergenic
952359372 3:32614422-32614444 GTGGTAGTCCCAGGGTCCTATGG - Intergenic
952821807 3:37492343-37492365 GGGGCAGTCCCAGCTTGGGAAGG + Intronic
953624118 3:44556694-44556716 GGGGTAAGGCCAGGTTGTGAAGG + Intronic
959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG + Intronic
960603667 3:119482885-119482907 GGGGTAGCACCAGGCTGTGGTGG + Intronic
962309329 3:134314121-134314143 GGGGGAAGCCCAGGGTGTGGGGG + Intergenic
962530612 3:136276898-136276920 GGGGTATTCCCTTGGTGTGGTGG + Intronic
962806095 3:138928841-138928863 GGGGTGGTCCCTGGGTGTCGCGG + Intergenic
963872114 3:150428324-150428346 GGGGCAGGCCCAGGGTAGGAGGG + Intronic
964048536 3:152361585-152361607 GGGTTAGGCCCAGGTTATGAGGG + Intronic
966862036 3:184236011-184236033 GGGAGAGGCCCTGGGTGTGAGGG - Intronic
966909623 3:184551774-184551796 GGGGCAGTCACAGGGACTGAAGG - Intronic
968541744 4:1171614-1171636 GGGGCAGCCACAGGGTGTCACGG - Intronic
968641415 4:1716847-1716869 GGGGTAGACCCAGGGTCTCCAGG + Exonic
968984426 4:3867372-3867394 GGGCTGGTCTCAGGGTGGGAGGG + Intergenic
975275526 4:72495258-72495280 GGAATAGTCCCAGGGTCTGTGGG + Intronic
977053650 4:92162584-92162606 GGTGTTGCCCCAGGTTGTGAGGG - Intergenic
978129836 4:105182314-105182336 TGGGTAGACCCAGGGAGTAATGG - Intronic
983070776 4:163265493-163265515 GGTGACATCCCAGGGTGTGAGGG + Intergenic
985672811 5:1214866-1214888 AGGGTGGGCCCTGGGTGTGAGGG + Intronic
988551540 5:32204868-32204890 GGGGCAGTCCCAGGGAGCAAGGG + Intergenic
990921577 5:60973983-60974005 TGGGTAGAGACAGGGTGTGATGG + Intronic
992356889 5:75994971-75994993 GAGTAAGTCCCAGGGTCTGAAGG + Intergenic
992551235 5:77862202-77862224 GGGGAAGTTCCTGGGTGTGTGGG - Intronic
993755908 5:91729388-91729410 GTGATAGTGGCAGGGTGTGAGGG - Intergenic
1002465405 5:179405873-179405895 AGGGTATCCCCAGGGAGTGATGG + Intergenic
1003397026 6:5762519-5762541 GGAGAAGTCACAGGGAGTGATGG + Intronic
1005692629 6:28322110-28322132 GGGTGAGTCCCAGGGTGAGTGGG - Intergenic
1006022029 6:31122940-31122962 TGGGCCGTCCCAGGGTGTGAGGG + Intronic
1006022738 6:31126879-31126901 GGGGTGGCCTCAGGGTGTGACGG - Intronic
1006257938 6:32845804-32845826 AGGGTAGTCCCCGGCTCTGACGG - Intronic
1007089210 6:39171837-39171859 GGGGATGACCCAGGGTTTGAAGG + Intergenic
1007260408 6:40559424-40559446 TGGGGATTCCCAGGGTGTGGGGG - Intronic
1007654582 6:43444644-43444666 GGGGTAGTGGCAGGGTGGGGAGG + Intronic
1008875941 6:56327879-56327901 GGGTTAGTCCCATTGTGAGATGG - Intronic
1013330758 6:109097736-109097758 TGGGGAGTGCCAGGATGTGAGGG + Intronic
1014295183 6:119609090-119609112 GTGGTAGTTCTAGGGAGTGAAGG + Intergenic
1015400350 6:132781367-132781389 GGGGTTGTCCTCAGGTGTGAGGG + Intronic
1019106000 6:169667647-169667669 GAGCCAGTCCCAGGGTGTGGAGG - Intronic
1020257108 7:6508514-6508536 GGGTTAGCCTCAGGCTGTGAGGG + Intronic
1020394544 7:7699555-7699577 AGGGTGGTCCCTGGATGTGATGG + Intronic
1021170254 7:17390928-17390950 GAGGTGGTCCCAGGGAGAGAAGG + Intergenic
1023980259 7:45065439-45065461 GGGCCAGTGGCAGGGTGTGAAGG + Intronic
1029335912 7:99899108-99899130 GGGTTATTCTCAGGGTGTGCTGG - Intronic
1029514641 7:101017759-101017781 GAGGGAGTCCCAGGGGGAGAAGG - Intronic
1029514943 7:101018390-101018412 GGGGTGGCCCCAGGGTGAGGAGG - Intronic
1035260014 7:157655138-157655160 GGGCTCGCCCCAGGGAGTGATGG + Intronic
1036217348 8:6891734-6891756 GGGGTAGGACCCAGGTGTGATGG + Intergenic
1039711659 8:40061587-40061609 GGAATTGTCCCAGGGTGTGAAGG - Intergenic
1041252246 8:55945880-55945902 TGGGCAGTCCCAGGCTGGGACGG + Intronic
1041407444 8:57515715-57515737 AAGGTGGTCCCAAGGTGTGAGGG + Intergenic
1045948969 8:107830079-107830101 GGGGTAGACACAGGGAGGGAGGG + Intergenic
1049624140 8:143612566-143612588 GGGGCAGTCCCTGGGTGTGGGGG + Intergenic
1050524109 9:6530638-6530660 GGGGCCGTCCCAGGGCCTGATGG + Intergenic
1050952686 9:11618091-11618113 GTCGAAGTCCCAGGGTGCGAAGG - Intergenic
1053389008 9:37720031-37720053 GGGGGAGTCACAGGGGGTGGGGG + Intronic
1055923675 9:81488644-81488666 GAGGCAGTACCAGCGTGTGAGGG + Intergenic
1057499540 9:95585733-95585755 GAGGTGGTCTCTGGGTGTGATGG - Intergenic
1060749665 9:126160748-126160770 GGGGAAGTGCCAGGGCCTGAGGG - Intergenic
1060802700 9:126554664-126554686 GGGGAAGACTCAGGGTGGGAGGG - Intergenic
1061392521 9:130325742-130325764 GAGGTAGGCCCAGTGTGTCATGG + Intronic
1061569511 9:131468146-131468168 GGGGTCCTCCCAAGGTGTAAGGG + Intronic
1062397288 9:136357605-136357627 GGGTCAGTCCCAGGCTGTGCTGG + Intronic
1203742581 Un_GL000218v1:15370-15392 GAGGTACTTCCAGGGTGTCAAGG + Intergenic
1189447690 X:41095927-41095949 GGGGTGCTCCCATGGTATGAGGG + Intronic
1190311874 X:49122634-49122656 GGTGGTGTCCCAGGCTGTGAAGG - Exonic
1192117463 X:68425100-68425122 GGTGTAGTGCCATGGTGTGCGGG - Intronic
1199241243 X:145550178-145550200 GGGAGAGTCCCTGGGGGTGAGGG - Intergenic
1201156112 Y:11132843-11132865 GGGGTACTTCCAGGGTGTCAAGG + Intergenic