ID: 1145818437

View in Genome Browser
Species Human (GRCh38)
Location 17:27812259-27812281
Sequence CAGTTTGCAGGCATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145818437 Original CRISPR CAGTTTGCAGGCATTGAGGA AGG Intronic
902517658 1:16998023-16998045 CAGCCTGCAGGCATTCAGTAAGG - Intronic
902551325 1:17221355-17221377 CAGTTGACTGGCATTGAGGTGGG + Intronic
903268886 1:22175493-22175515 CAGTTGGCAGGCATGGGGGCTGG + Intergenic
904788347 1:32999086-32999108 CAGTGTCCAGGCATTGAGCCAGG + Intergenic
906548904 1:46644974-46644996 CAATTTCTAGGTATTGAGGAGGG + Intronic
907897894 1:58709846-58709868 CACTTGGCAGGCATTGGGTATGG + Intergenic
910633662 1:89383472-89383494 CAGGAAGCAGGAATTGAGGAGGG + Intronic
911090350 1:94012544-94012566 CATTGTGCAGGTATTTAGGAAGG - Intronic
911141125 1:94503677-94503699 CTGTTTGCATGAAGTGAGGAAGG - Intronic
911879989 1:103224911-103224933 AAGTTTGTAGGCATTTAGAATGG + Intergenic
911936244 1:103977842-103977864 AGGTTTTCAGGCGTTGAGGAAGG - Intergenic
913083612 1:115413312-115413334 AAGTTTGCCAGCAATGAGGAAGG + Intergenic
918581384 1:186134512-186134534 CAGTTAGAAGGCATTGTGTAGGG + Intronic
920497468 1:206465483-206465505 CAGTTTGTAGGCTGTGAGCAGGG + Intergenic
920625421 1:207592834-207592856 CACTTTGCAGGAATTTAGAATGG - Intronic
921008824 1:211120923-211120945 CAGTTTGCAGTGATTGTGAATGG - Intronic
921083717 1:211767109-211767131 CAGTTTGATGTCATTCAGGATGG - Intronic
923921320 1:238566910-238566932 AAATTTGCAACCATTGAGGATGG + Intergenic
1063137886 10:3233028-3233050 CAGTTTGTGAGCCTTGAGGAGGG + Intergenic
1063205022 10:3822679-3822701 AAGTTTGCAGGCATGGAGTCTGG - Intergenic
1063361966 10:5466665-5466687 CAGTTTCCAGGCGTGGAGGGAGG - Intergenic
1066000476 10:31100228-31100250 AATTTTGCAGAAATTGAGGAGGG + Intergenic
1067158158 10:43799996-43800018 GAGGTTGCACGCATTGGGGATGG + Intergenic
1071056955 10:81522675-81522697 CTGTATGCAGGCATTGGGGTTGG + Intergenic
1072876986 10:99183093-99183115 CTGTCTGTAGGCATTGAGGTGGG - Intronic
1073951012 10:108809313-108809335 AAGTTTGAAAGCATTGAGGGGGG - Intergenic
1074385355 10:113012616-113012638 GGGTTTGCTGGCATTGAGTAAGG + Intronic
1077375106 11:2202111-2202133 CAGGTTCCAGGCATGGATGAGGG - Intergenic
1078806742 11:14713441-14713463 CAGTTTGAAGGCAGTCAGGTAGG - Intronic
1079036131 11:17021771-17021793 CAGCTTGCAGGCAGTCAGGCAGG + Intergenic
1080639195 11:34148929-34148951 CATTCTGCAGGCCTGGAGGAGGG + Intergenic
1084457122 11:69274301-69274323 CTGATGGCAGGAATTGAGGAAGG + Intergenic
1084974518 11:72789538-72789560 CAGCTGTCAGACATTGAGGAGGG - Intronic
1086561906 11:88177894-88177916 AATTTTGCAGGCATTTAGAATGG - Intergenic
1087083359 11:94193430-94193452 CAGATTGCAGGCTTGGAGGAAGG - Intergenic
1088959484 11:114648373-114648395 CAGTGTGAAGGCATTCAGGCAGG + Intergenic
1089679481 11:120111335-120111357 CAGCTTGCAGGGGTTGGGGAGGG - Exonic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091240106 11:134046413-134046435 CAACTTCCTGGCATTGAGGAAGG + Intergenic
1091690058 12:2589764-2589786 CAGTATCCAGGCAGAGAGGATGG + Intronic
1091760242 12:3082527-3082549 AAGTTTGCAGGTTTTGAGCAAGG + Intronic
1091919165 12:4290528-4290550 TTGTCTCCAGGCATTGAGGAAGG - Intronic
1092505041 12:9090062-9090084 GAGTTTGGAGGCATGGAGGAAGG - Intronic
1092902672 12:13074662-13074684 CATTCTGTAGGCAGTGAGGAAGG + Intronic
1092927472 12:13284717-13284739 CAGTGTGCAGGCCCTGAGAAAGG + Intergenic
1097017488 12:55997706-55997728 CAGGCTGCTGGCATTGAGGTAGG + Intronic
1098586536 12:72161037-72161059 CAATTTGCAGCCAGTGAGAAAGG - Intronic
1099054329 12:77819605-77819627 CAGTGGGAAAGCATTGAGGAGGG + Intergenic
1101847467 12:108374192-108374214 CAGTTTGCATGCTTGGATGAAGG - Intergenic
1102660649 12:114524660-114524682 CAGTTAGAAGGTATGGAGGAAGG - Intergenic
1103606361 12:122088627-122088649 CAGTTTTCAGGCTTTGGAGAAGG + Intronic
1103924787 12:124417511-124417533 CTGTTTGGGGGCATTGAGGCTGG - Intronic
1104138615 12:125964388-125964410 ATGTTTGCAGGCATTGAGCTTGG - Intergenic
1107315660 13:39128791-39128813 CAGTTTGCAGAAATAGCGGAGGG + Intergenic
1107950974 13:45462011-45462033 CAGGTTTGAGTCATTGAGGAGGG + Intergenic
1108024053 13:46160183-46160205 CAGGTTGCTGGCATTGATGCTGG - Intronic
1108757306 13:53519277-53519299 CAGTTGGAAGGCATTAAGGGAGG + Intergenic
1111583762 13:90258302-90258324 CAGCATGGAGGCATTGATGATGG - Intergenic
1113881252 13:113627915-113627937 CACTGTGCAGCCAGTGAGGAGGG + Intronic
1114239808 14:20856168-20856190 CAGATTCCAGGCATTAGGGAAGG + Intergenic
1114426341 14:22626823-22626845 GAGGGTGGAGGCATTGAGGAGGG - Intergenic
1115422660 14:33215179-33215201 CAGTTTACAAGCATTGAGAAAGG + Exonic
1116120252 14:40713692-40713714 CAGCTTGAAGGCAGTGAGGCAGG + Intergenic
1116655625 14:47650140-47650162 CAGTTTGAAGGCAGTCAGGCAGG - Intronic
1116970159 14:51055574-51055596 AAGTTTGCTGGTTTTGAGGATGG + Intronic
1117519795 14:56539958-56539980 CAGTTCAAAGGCATTCAGGAAGG - Intronic
1117836207 14:59808870-59808892 AAGTCTGCAATCATTGAGGAAGG - Intronic
1117905152 14:60577096-60577118 CAGCTTGCAGGCAGTTAGGGAGG - Intergenic
1118137714 14:63046445-63046467 CAATTTCCAGGCGTTGAGAACGG + Intronic
1118642832 14:67808218-67808240 CATTTTGGAGGCAGTGAGGTGGG - Intronic
1119608657 14:76043237-76043259 CAGTTGACAAGCATTGAGGAAGG + Intronic
1120312931 14:82854480-82854502 CAGTTTCTAGGCATTTATGATGG - Intergenic
1124235163 15:27983821-27983843 CAGTGTGGAGGCAGTGCGGATGG + Intronic
1124260624 15:28187024-28187046 GAGTTTGCAGTCATTCAGTAAGG - Intronic
1127822713 15:62674173-62674195 CTGTTAACATGCATTGAGGAAGG + Intronic
1128116999 15:65114414-65114436 CAGAATACAGGCAATGAGGAAGG - Intronic
1128245385 15:66129077-66129099 CAGTTTGCAGGCTTTGATCCAGG + Intronic
1128693902 15:69746021-69746043 CAGCTTGCAGGCAGGGAGAAGGG - Intergenic
1129128532 15:73467963-73467985 GTGATTGCTGGCATTGAGGATGG - Intronic
1135131926 16:19860246-19860268 TAGTTTGCGGGGATTGAGGTTGG + Exonic
1140587196 16:76307240-76307262 CAATTTGCAGGTATTGAGAATGG + Intronic
1141098473 16:81179757-81179779 GAGTCTGCAGGCATCCAGGAGGG + Intergenic
1141479499 16:84296902-84296924 CAGAGGGGAGGCATTGAGGAGGG + Intronic
1142959516 17:3543743-3543765 GAGTTTGCAGGCATTGTGACAGG - Intronic
1143595722 17:7912436-7912458 CTGTATCCAGGCCTTGAGGAGGG - Exonic
1143848293 17:9790044-9790066 CAATCTGCACGCTTTGAGGATGG - Intronic
1144631546 17:16875287-16875309 CATTTTGCAGCCATTTAGAATGG - Intergenic
1145241090 17:21241449-21241471 CAGGTTGTAGGCACAGAGGATGG - Exonic
1145276486 17:21434412-21434434 CATGTTGCTGGGATTGAGGATGG - Intergenic
1145314327 17:21720305-21720327 CATTTTGCTGAAATTGAGGATGG - Intergenic
1145712779 17:26992281-26992303 CATTTTGCTGGGATTGAGGATGG - Intergenic
1145818437 17:27812259-27812281 CAGTTTGCAGGCATTGAGGAAGG + Intronic
1146423865 17:32716791-32716813 CAGTTTGCTGGCATGAAAGAAGG - Intronic
1148549213 17:48540434-48540456 CATTTTTTTGGCATTGAGGAAGG + Intergenic
1148693778 17:49547323-49547345 CAGTTTGCGGGCAGCCAGGATGG + Intergenic
1149550138 17:57533773-57533795 CAGCGTGCAGGCATCAAGGATGG - Intronic
1150255116 17:63738389-63738411 AAGTTGGGAGGCAGTGAGGAGGG + Intronic
1151829960 17:76543654-76543676 CAGTTTGCAGGGGTTGGGGGTGG + Intronic
1152227447 17:79098955-79098977 CAGACTGGAGGCAGTGAGGACGG + Intronic
1158334768 18:56404224-56404246 CAGTTTGAAGGAACTGAGGTGGG + Intergenic
1158774651 18:60562990-60563012 CAGTTGGGAGACATAGAGGATGG - Intergenic
1159408209 18:68034015-68034037 GAGTTTGCAGTCAATGATGACGG + Intergenic
1162141166 19:8586334-8586356 CAGTGTGCAGGCGGTGAGGCCGG - Exonic
1162588348 19:11575240-11575262 CATCTTGCAGGTACTGAGGATGG + Exonic
928824658 2:35405527-35405549 CTGTGTGCAAGCACTGAGGAAGG - Intergenic
930000576 2:46859033-46859055 CAGTTCTCAGGCATTGTGTATGG - Intergenic
931648782 2:64450176-64450198 CAGATGGCAGGCATGGTGGAAGG + Intergenic
932232366 2:70093462-70093484 CAGTTTGCAGGAGGAGAGGAGGG + Intergenic
932557330 2:72836115-72836137 CAGGTAGAAGGCATTGGGGAAGG - Intergenic
932914767 2:75844785-75844807 CAGTTTTGAGGCAGTGGGGATGG + Intergenic
933187433 2:79293548-79293570 CAATTTAAAGGCATAGAGGATGG + Intronic
933706760 2:85297118-85297140 CTGTTTGCTGGCATTAAGGGTGG - Intronic
935271756 2:101440853-101440875 CAGTGTGCATACATTTAGGATGG + Intronic
937343839 2:121110432-121110454 CACTGAGCAGGCATTGAGAAGGG + Intergenic
938566417 2:132522890-132522912 CAGTTTTCAGGCATTAAGGAAGG - Intronic
938611344 2:132950479-132950501 CAGTTTTCAGACACTGAGGATGG + Intronic
939038254 2:137158431-137158453 CAGTTTGCAAGCCATGTGGAGGG - Intronic
939536416 2:143436514-143436536 CAGTTTGTTGCCATTGAGGATGG + Intronic
939894935 2:147780033-147780055 CAGTTTGCAGTAATGGAGTAAGG - Intergenic
940118325 2:150235233-150235255 CAGTTTGCAGTCTTAGAGGATGG - Intergenic
940529649 2:154864899-154864921 CATTTTGCTGGCTTTGATGATGG - Intergenic
941320544 2:164049005-164049027 CAGTTTGAAGGCAGTCAGGCAGG - Intergenic
943611850 2:190044213-190044235 CAGCTTGGAGGCAGAGAGGAAGG + Intronic
947024409 2:225720678-225720700 CAGTTTGAAGGCAGTCAGGCAGG + Intergenic
947457740 2:230270989-230271011 CATGTTGCAGGCTTTGAAGATGG + Intronic
1168983345 20:2026450-2026472 CACATTGCAGGCAATGAGAAGGG - Intergenic
1169034700 20:2440070-2440092 GAGTTTGAAGGCAGTGAGGCAGG + Intergenic
1170694691 20:18647732-18647754 CAGTGGGCAGCCACTGAGGAGGG + Intronic
1173010989 20:39181837-39181859 CAGTTTGAAGGCAGTCAGGCAGG - Intergenic
1173108683 20:40163805-40163827 CAGTTTACACGCATTGATAAGGG + Intergenic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1173922379 20:46756115-46756137 CAGCTTGCAGCCTTTGGGGACGG + Intergenic
1174079492 20:47960874-47960896 CAGGTTGCAGGGATGCAGGAAGG - Intergenic
1176188565 20:63795425-63795447 CATTGTGCAGGCAGTGAGGGGGG + Intronic
1176671002 21:9735517-9735539 CAGCTTGCAGGAAGTGTGGAGGG + Intergenic
1177040719 21:16106903-16106925 CCGGGTGCTGGCATTGAGGAGGG + Intergenic
1177770095 21:25504479-25504501 CAGTTTGAAGGCTGTCAGGAAGG - Intergenic
1178134390 21:29610512-29610534 AAGATTGCTGGCTTTGAGGATGG + Intronic
1178176950 21:30112688-30112710 CATTCTGCAGGCATTAATGAAGG + Intergenic
1178473431 21:32916035-32916057 TAGTTTGCAGGCAGTCAGGCAGG + Intergenic
1179255278 21:39710588-39710610 CAGTTTTCAGCCATTCAGAAGGG - Intergenic
1181081786 22:20420399-20420421 CTGCTTGCAGTCATTGGGGATGG + Intergenic
1181992571 22:26848539-26848561 GCGTCTGCAGGCATAGAGGATGG + Intergenic
1183119305 22:35717798-35717820 CAGGTTTCAGGCATGGAGAAGGG + Intergenic
1183907746 22:41055020-41055042 CACTTAGCTGGCTTTGAGGATGG - Intergenic
1184489333 22:44800042-44800064 TGGTCTGCAGGCATGGAGGATGG + Intronic
950893446 3:16426068-16426090 CAGAGAGCAGACATTGAGGAAGG - Intronic
956178345 3:66495403-66495425 CAAATTGCAGTCACTGAGGAGGG + Intronic
960022149 3:112966881-112966903 GAGATTGCTGGTATTGAGGAGGG - Intronic
962056012 3:131872430-131872452 CAGTTTGAAGGCAGTTAGGCAGG + Intronic
962401889 3:135067564-135067586 CAGTTTCCAGGCAGTGGGCAAGG + Intronic
964894946 3:161584416-161584438 CAGATTGCTGGCTTTGAGGATGG - Intergenic
965788777 3:172365034-172365056 CAGTTTCAAGACACTGAGGAAGG - Intronic
966653547 3:182327513-182327535 CAGTTTCCAGGCATAGAGTTTGG - Intergenic
967446283 3:189570486-189570508 CAGTTTGCAAGAACTGATGATGG - Intergenic
968050227 3:195648894-195648916 CAGTTTGCAGGCAGTGCAGCTGG + Intergenic
968105601 3:195999365-195999387 CAGTTTGCAGGCAGTGCAGCTGG - Intergenic
968303879 3:197636947-197636969 CAGTTTGCAGGCAGTGCAGCTGG - Intergenic
968423587 4:505708-505730 CTGACTGCAGGCATTGATGACGG + Exonic
968957819 4:3728118-3728140 CCGTCTGCAGGCCTGGAGGAGGG + Intergenic
969847879 4:9933860-9933882 AAGGTTGCTGGCATTGAAGATGG - Intronic
969973140 4:11068948-11068970 TACTTTGCTGGCCTTGAGGAAGG + Intergenic
971715116 4:30166103-30166125 CAGTTGGCAGGTGTTGAGGGTGG + Intergenic
973818830 4:54644523-54644545 AAGCTTGCATGCATGGAGGAGGG - Intergenic
977037714 4:91976151-91976173 CAGTTTGCATGCTTGGAGGAGGG - Intergenic
977858016 4:101919107-101919129 CTGTATGCAGGCATTGAATAGGG + Intronic
978110994 4:104963962-104963984 CAGTCTGTGGGCATTAAGGATGG - Intergenic
980992370 4:139748841-139748863 GAGTTTGCAGGCCTTGAAAATGG - Intronic
981035898 4:140168657-140168679 CAGTTTGAAGGCAGTCAGGCAGG - Intergenic
981219772 4:142217859-142217881 CAGTTTGAAGGCAGTCAGGCAGG - Intronic
982445652 4:155487709-155487731 CAGTTTGAATTCATTGAAGAGGG + Intergenic
982618993 4:157679250-157679272 CAGTTTGGAGGCCTAGAAGAGGG - Intergenic
985523000 5:387787-387809 CAGTTTGCAGTCATTCATTAAGG - Intronic
986305271 5:6509591-6509613 CAGCTAGCAAGTATTGAGGAAGG - Intergenic
990812646 5:59746622-59746644 GAGTTTGCAGGAATTGGGGAAGG - Intronic
992091632 5:73322838-73322860 CAGTGTGCAGTGACTGAGGAAGG + Intergenic
994066751 5:95552298-95552320 CAGTTTGGAGGTTTGGAGGAGGG - Intronic
995377622 5:111493950-111493972 AAGTTAGCAGACATTGAGAAAGG + Exonic
996207272 5:120756355-120756377 CAGTTTGGAGGTCTGGAGGAAGG - Intergenic
996386823 5:122917527-122917549 CAGTTTTCAAACATTCAGGACGG + Intronic
997237950 5:132285101-132285123 CAGTTTGCATTCATTTGGGAGGG - Intronic
999638357 5:153645949-153645971 CAATTTTTAGGCATTGAAGATGG + Intronic
1000415679 5:160981135-160981157 CAGTTTGCACGCAGAGAGAAAGG - Intergenic
1002703732 5:181146603-181146625 CAGTTTGCAGGGCTTTATGAAGG - Intergenic
1006716273 6:36122730-36122752 CAGGTTGCAGGCATTGTGCATGG - Intergenic
1008193305 6:48486806-48486828 CAGTTTCCAAGGATGGAGGAGGG + Intergenic
1015648740 6:135428658-135428680 CTGTTTGCTGGAAGTGAGGATGG - Exonic
1022133495 7:27425515-27425537 TTGGTTGAAGGCATTGAGGAGGG + Intergenic
1023327183 7:39073169-39073191 TAGTTTGCATGGATTGGGGATGG - Intronic
1026248616 7:68646936-68646958 CAGTCTGATGGCATAGAGGATGG + Intergenic
1028274600 7:88839021-88839043 TAGTTATCAGGCATTGAAGATGG - Intronic
1029443880 7:100602491-100602513 CAGGGCGCAGGCAGTGAGGAGGG - Exonic
1029910914 7:104146629-104146651 CAGTTAACAGGAATTGGGGAAGG + Intronic
1030539319 7:110810033-110810055 CAGATGGCAGGCATTTAGGAAGG - Intronic
1030777599 7:113553657-113553679 AAGTTTGCAGTCATGGTGGAAGG + Intergenic
1032600487 7:133288541-133288563 AAATTTGCAAGCATTGGGGAAGG + Intronic
1033794853 7:144835212-144835234 GACATTGCAGGCATTAAGGACGG - Intronic
1035201880 7:157272961-157272983 CAGTGGGCAGGAACTGAGGACGG - Intergenic
1036571455 8:9983254-9983276 CAGTGGGCAGGCATGCAGGAGGG + Intergenic
1038220803 8:25605157-25605179 GAGTTTGCAGGAAATGAGGAGGG + Intergenic
1038388912 8:27176318-27176340 CAGTGAGCAGAGATTGAGGAAGG + Intergenic
1038505424 8:28080236-28080258 AAGTTTGCAGGCAGTAAGGTTGG - Intronic
1039212906 8:35236155-35236177 CAGTCTGCAGCAATTGGGGAGGG - Intronic
1041337337 8:56801093-56801115 GAGTTTGCTGGCTTTGAAGATGG + Intergenic
1042670613 8:71258894-71258916 CAGCTTACAAACATTGAGGAAGG + Intronic
1044731635 8:95233059-95233081 CTGTTGGCAGGGATTGAGAATGG - Intergenic
1045270335 8:100655878-100655900 CAGTGTGCAGGGAATGAGGGGGG + Intronic
1045506903 8:102785191-102785213 CTGTTGGCAGGCAGTGAGGGGGG - Intergenic
1050258806 9:3819576-3819598 AAGTTCTCAGGAATTGAGGAAGG - Intergenic
1051144571 9:14012975-14012997 CTGTTTGCAGGCATTGCGCTAGG + Intergenic
1055586985 9:77765198-77765220 CATTCTCCATGCATTGAGGAAGG + Intronic
1056680073 9:88709396-88709418 CAGTTTGGCTGGATTGAGGAGGG - Intergenic
1057751310 9:97795636-97795658 CAGTTTGGAGGCAGTCAGGCAGG + Intergenic
1058142466 9:101371874-101371896 CTGTTTCCAGGACTTGAGGAAGG - Intronic
1058345366 9:103954655-103954677 CAATTTGAAGGCAATCAGGAAGG + Intergenic
1059311806 9:113393467-113393489 GAGGTTGGAGGCATTGAGGGTGG + Exonic
1059396353 9:114036408-114036430 CAATTTGCAGGAACTGAGGAAGG - Intronic
1185843239 X:3413038-3413060 CACCTTGCAGGCTTTGAAGATGG - Intergenic
1186269822 X:7874687-7874709 CAGGTGGCTGCCATTGAGGAAGG + Intergenic
1186579090 X:10797939-10797961 CAGAGAGCAGGCATTGAGTAGGG + Intronic
1186939035 X:14484329-14484351 CACTTTGCATTCCTTGAGGAAGG + Intergenic
1188504701 X:30869398-30869420 AACTTTGTAGGCATTTAGGAGGG - Intronic
1190469112 X:50759008-50759030 CAGATTTCAAGAATTGAGGAGGG - Intronic
1190708635 X:53049831-53049853 CAGGGTGCAGGCATTGTGAAGGG - Intronic
1191013599 X:55786924-55786946 CAGCTTGGAGGCATTGAGGAAGG + Intergenic
1193219070 X:78900646-78900668 CAGTTTGGAGGAAGTTAGGAAGG + Intergenic
1193835787 X:86342209-86342231 CAGTTTGCAGCCAGTCATGATGG + Intronic
1194070620 X:89321441-89321463 TATTTTGCATTCATTGAGGAGGG - Intergenic
1195212184 X:102660615-102660637 CAGTATTCAGGCAGTGGGGATGG + Intergenic
1195218223 X:102721361-102721383 CAGTATTCAGGCAGTGGGGATGG + Intronic
1195462617 X:105144738-105144760 AAATTGGCAGGCATTGGGGATGG - Intronic
1197802484 X:130366339-130366361 CAATTTGGAAGCATTGAGGTAGG + Intronic
1198176969 X:134166105-134166127 AAGTTTGGAGGCCTGGAGGAAGG - Intergenic
1198868760 X:141154013-141154035 CAGTTTGAAGGCAGTCAGGCAGG + Intergenic
1199025774 X:142935785-142935807 CAATGTGCAGGCATTGTGAAGGG - Intergenic
1199386503 X:147229421-147229443 CAGTTTGGAGGCAGTCAGGCAGG - Intergenic
1200724862 Y:6657183-6657205 TACTTTGCATTCATTGAGGAGGG - Intergenic
1201231953 Y:11873541-11873563 CACCTTGCAGGCTTTGAAGATGG + Intergenic