ID: 1145823647

View in Genome Browser
Species Human (GRCh38)
Location 17:27859942-27859964
Sequence GACAGCCGAGTGACTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145823647_1145823649 8 Left 1145823647 17:27859942-27859964 CCATCTCTAGTCACTCGGCTGTC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 1145823649 17:27859973-27859995 TTCCTGACCTGCCCTCCTTCAGG 0: 1
1: 0
2: 5
3: 26
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145823647 Original CRISPR GACAGCCGAGTGACTAGAGA TGG (reversed) Intronic
904490200 1:30853835-30853857 GGAGGCCGAGAGACTAGAGAAGG - Intergenic
907453955 1:54563302-54563324 GGCAGCCCAGTGAGTAGAAATGG + Intronic
910198513 1:84672450-84672472 GAAAGGGGAGTGGCTAGAGAAGG + Intronic
910763946 1:90762021-90762043 GACAGCCGAGGGAGGAGGGACGG + Intergenic
918425776 1:184408393-184408415 GCCAGCCGAATGAACAGAGAAGG + Intronic
920844162 1:209579490-209579512 GACAGCCAAATGACAAGACATGG - Intergenic
923109558 1:230879892-230879914 GAGAGCAGGGTGACTGGAGAGGG - Intergenic
1064255444 10:13739351-13739373 AACAGCAGATTGACCAGAGAAGG + Intronic
1066446259 10:35486535-35486557 CACAGACCAGGGACTAGAGAGGG - Intronic
1067164642 10:43855665-43855687 GATAGAAGAGTAACTAGAGAAGG - Intergenic
1078424571 11:11238797-11238819 GCAAGCCAAGTGACTAGAAATGG + Intergenic
1082896235 11:58193193-58193215 CACAGCCTAGTGAGTAGTGATGG + Intergenic
1084044147 11:66559467-66559489 GAGAGCCTAGTGTCTTGAGAAGG - Intronic
1084519799 11:69656223-69656245 CACAGCCAAGTGTGTAGAGAGGG + Intronic
1085639052 11:78179784-78179806 GACAGCAGAGAGGGTAGAGAAGG - Intronic
1085899101 11:80676314-80676336 CAGAGCCCAGTGGCTAGAGATGG - Intergenic
1101964162 12:109270900-109270922 GCCAGCCGCGTGGCCAGAGAGGG + Intergenic
1102224555 12:111218632-111218654 GACAGCAGAATGCCAAGAGAGGG - Intronic
1107393246 13:39989455-39989477 GACAGCCTACTGAGGAGAGATGG - Intergenic
1109785058 13:67162654-67162676 AACTCCCGAGTGAGTAGAGAAGG + Intronic
1112357812 13:98689423-98689445 GCCAGCCCAGTAACAAGAGACGG + Intronic
1119635627 14:76270952-76270974 GACATCTGAGTGACAAGAGTAGG - Intergenic
1122675334 14:103408063-103408085 GACAGCCTACAAACTAGAGAAGG - Intronic
1123630508 15:22257455-22257477 GGCCGCCGAGAGACTAGAGGCGG + Intergenic
1125138750 15:36377498-36377520 CACAGCAGGGTGACTAGAGTCGG - Intergenic
1130677317 15:85964723-85964745 GACAGCCATGTGCCTAGAGGAGG - Intergenic
1131481746 15:92788235-92788257 GTCAGCTGAGTGACAGGAGAAGG + Intronic
1133358429 16:5154262-5154284 GACAGCCAAGTGACTGGAGTAGG + Intergenic
1135575858 16:23585076-23585098 AAGAGCCGAATGACCAGAGATGG - Intronic
1135930006 16:26728229-26728251 GACAGCCTGGTCTCTAGAGAAGG + Intergenic
1136398950 16:30007465-30007487 GACAGCCGGGTGGCTGCAGAGGG - Intronic
1136557095 16:31013706-31013728 GACAGGAGAGGGCCTAGAGACGG - Intergenic
1142234235 16:88914271-88914293 GACAGCGCAGTGACCAGAGGGGG + Intronic
1145823647 17:27859942-27859964 GACAGCCGAGTGACTAGAGATGG - Intronic
1147328296 17:39680797-39680819 GAGAGCCTAGTGAAAAGAGAAGG - Intronic
1147871786 17:43592607-43592629 GGCAGCCAAGTGGCTAGAGATGG - Intergenic
1148000100 17:44382836-44382858 GACAGAGGAGTGTCCAGAGAGGG - Intronic
1150236527 17:63597264-63597286 GACAGCCAGGCGTCTAGAGATGG + Intergenic
1150426334 17:65079890-65079912 GACAGCCATGTGAATAGAGAGGG - Intergenic
1153411449 18:4798322-4798344 GACAGCTGTGTGTCTAGAAAAGG - Intergenic
1157489064 18:48109659-48109681 GACAGCCGAGTGACAAGGGAGGG + Intronic
1157962895 18:52176614-52176636 GACAACAGAGAGGCTAGAGATGG + Intergenic
1162973073 19:14192973-14192995 GACAGGGGAGTGACTAAGGACGG + Intronic
1163510816 19:17733979-17734001 GAGATCCAAGTGAGTAGAGAGGG + Intronic
927706260 2:25298282-25298304 CACAGCCGAGTGAGGGGAGAGGG - Intronic
930775675 2:55167752-55167774 GTCAGCTGAGTGTCTAGAGGAGG - Intergenic
938094763 2:128454249-128454271 GACTGCCCAGGGACTAGACAGGG - Intergenic
938539595 2:132275276-132275298 GACAGACAGGTGACTAGACAAGG - Intergenic
1170676866 20:18490341-18490363 GACAGCCCCATGTCTAGAGAAGG + Intronic
1171868520 20:30508185-30508207 GACAGACAGGTGACTAGACAGGG - Intergenic
1174042862 20:47712415-47712437 AACAGCCCGGTGACTATAGAGGG - Intronic
1181001654 22:19990560-19990582 AACAGCCTAGTGACTTGGGAAGG - Intronic
1181162386 22:20966282-20966304 GACAGCCTAGTGCCCAGGGAAGG + Intronic
1181572193 22:23773662-23773684 GACAGCAGAGTGAGGAGAGGAGG + Intronic
1182709684 22:32312705-32312727 GACAGCCGAGGTGGTAGAGAAGG - Intergenic
1185264719 22:49894915-49894937 GACAGCTGAGTGAGGAGAGAGGG + Intergenic
953329751 3:42043172-42043194 GACAGCTGAGTGCCTTGAAATGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
968541135 4:1168984-1169006 GCCAGCCGAGGGACCAGAGTGGG - Intronic
969806144 4:9610476-9610498 GAGAGCCAAGTGACTGGAGTAGG - Intergenic
975844725 4:78513038-78513060 TAAAGCTGAGTGACTAGAGAGGG - Intronic
979237570 4:118419755-118419777 GTCAACCCAGTGGCTAGAGAAGG + Intergenic
983351073 4:166589113-166589135 GGCAGACTAGTGACTAAAGAGGG - Intergenic
985250955 4:188023807-188023829 GACAGCCAGGTGGCTAGTGACGG + Intergenic
986598811 5:9450592-9450614 GACAGCTGGGTGAGTGGAGAGGG - Intronic
987104017 5:14619087-14619109 TACAGACGATTGTCTAGAGATGG - Intergenic
995289688 5:110437483-110437505 GAGAGCCAAGTGATTAGGGAAGG + Intronic
1006358633 6:33575255-33575277 GACAGAGGAGTGACTGGAGCTGG + Intronic
1009802810 6:68563451-68563473 TAGAGGAGAGTGACTAGAGATGG - Intergenic
1017286006 6:152677209-152677231 GAGTGGGGAGTGACTAGAGATGG - Intergenic
1019026435 6:168968419-168968441 GTCAGCCAAGTGAGTAGAAAGGG - Intergenic
1019230574 6:170557879-170557901 GCCAGCAGAGTGACTATAAAGGG - Intronic
1019570399 7:1708763-1708785 CACCGCCAAGTGACTAGAGCTGG + Intronic
1035582953 8:751423-751445 GACGGCCGAGTGAGGACAGATGG - Intergenic
1036472934 8:9066767-9066789 GACAGGCGGGTGAGTTGAGAGGG + Intronic
1037648552 8:20816076-20816098 AACAGCCGTGTTACTACAGATGG - Intergenic
1045847439 8:106655139-106655161 GACTGGGGAGTGACTACAGATGG + Intronic
1047712552 8:127566981-127567003 GACAGCCCAGTGGTTATAGAGGG - Intergenic
1048404091 8:134101492-134101514 GGCAGGGGAGTGTCTAGAGAAGG + Intergenic
1055656307 9:78453234-78453256 GACAGAGGAGTGACGAGTGAGGG + Intergenic
1059992858 9:119881644-119881666 GACAGCTTGGTGCCTAGAGAAGG + Intergenic
1061283398 9:129609772-129609794 GACAGACAAGTGGCTACAGAGGG + Intronic
1185706380 X:2270387-2270409 GACAGCCGAGATTCAAGAGACGG + Intronic
1198163957 X:134034946-134034968 TGCAGCAGAGTGAGTAGAGAAGG - Intergenic
1200251537 X:154556776-154556798 TACAGCCGAGTGACCAGGGTTGG - Intronic
1200266230 X:154647640-154647662 TACAGCCGAGTGACCAGGGTTGG + Intergenic