ID: 1145825939

View in Genome Browser
Species Human (GRCh38)
Location 17:27877401-27877423
Sequence AATCCCAGTCTGTCACTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145825939_1145825941 18 Left 1145825939 17:27877401-27877423 CCACTAAGTGACAGACTGGGATT 0: 1
1: 1
2: 2
3: 8
4: 129
Right 1145825941 17:27877442-27877464 TCTCCAGAGCCCCCTCCAGCAGG 0: 1
1: 2
2: 3
3: 35
4: 361
1145825939_1145825944 27 Left 1145825939 17:27877401-27877423 CCACTAAGTGACAGACTGGGATT 0: 1
1: 1
2: 2
3: 8
4: 129
Right 1145825944 17:27877451-27877473 CCCCCTCCAGCAGGCCACACTGG 0: 1
1: 0
2: 7
3: 32
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145825939 Original CRISPR AATCCCAGTCTGTCACTTAG TGG (reversed) Intronic
902479998 1:16706718-16706740 AGTCCCAGTAGGTCACTTCGTGG + Intergenic
904541489 1:31236758-31236780 AACCCCACTCTTCCACTTAGAGG - Intronic
905416178 1:37806129-37806151 AATCTGAGTCAGTCACTTAATGG + Intronic
905846038 1:41233144-41233166 AGTCCCAGTTTGCCACTCAGTGG - Intronic
909469913 1:76015594-76015616 CATTCTAGTCTTTCACTTAGAGG - Intergenic
909850544 1:80457521-80457543 ATTCCTCATCTGTCACTTAGAGG + Intergenic
911284764 1:95975669-95975691 AATCCCAATATCTCATTTAGTGG - Intergenic
914782565 1:150798997-150799019 ATTCTCAGTCTGACACTTAATGG - Intronic
915451508 1:156008652-156008674 AATCTCGCTCTGTCACCTAGTGG - Intergenic
915943189 1:160131900-160131922 AGTCCCAGTCCATCACTTACTGG - Intronic
916748393 1:167702089-167702111 ACTCCCAGTATCTCACATAGTGG - Intronic
917157127 1:172015296-172015318 AATCCCAGTCAGTTATTTTGTGG - Intronic
918860783 1:189824345-189824367 AATTACAGTATGTCACTTAGTGG - Intergenic
922655051 1:227374768-227374790 AATCCCAGCTTTTCCCTTAGAGG - Intergenic
922695075 1:227727082-227727104 AAATCCAGTTTGTCACTTGGAGG - Intergenic
1066573643 10:36801830-36801852 AATGCCAGGCTGTGACTCAGAGG - Intergenic
1067915485 10:50393431-50393453 AATCACTGCCTGTCACTTAACGG + Intronic
1068226392 10:54112112-54112134 AGTCTCACTCTGTCACTCAGTGG - Intronic
1068373828 10:56153583-56153605 AAACACAGTCTGTGTCTTAGAGG + Intergenic
1070490459 10:76971045-76971067 AAACCCAGCCTGTCACCCAGGGG + Intronic
1071491183 10:86137636-86137658 AATCCCAGGCTGTCCATTACTGG + Intronic
1074849468 10:117427581-117427603 AATCCCACTCTGCCACATGGGGG - Intergenic
1079759193 11:24307798-24307820 AATCACAGTCTGTAATTTATTGG + Intergenic
1084571465 11:69962475-69962497 CATCCCAGATTGTCCCTTAGAGG + Intergenic
1084615864 11:70235452-70235474 AACCCCAGTCTGTGACTTCAAGG - Intergenic
1085419633 11:76344496-76344518 AATCCCACTCTACCACTGAGTGG + Intergenic
1088397418 11:109383658-109383680 AATCTCATTCTGTCAGTCAGAGG - Intergenic
1090095709 11:123740580-123740602 GATCCCAGGCTCTCAATTAGAGG - Intronic
1093267424 12:17019985-17020007 AATGCCAGTCTGTCTAGTAGAGG - Intergenic
1093705671 12:22272659-22272681 AATCCCAGTCATTCGCTTTGTGG + Intronic
1094665784 12:32519252-32519274 AAACACAGTCTGTCCCTTTGAGG + Intronic
1097287336 12:57888341-57888363 AATCCCAGCCTGGCTCTTGGTGG + Intergenic
1099885984 12:88531322-88531344 ATCCCCAGTTTGTCTCTTAGTGG - Intronic
1103014949 12:117486956-117486978 AATCCTGATCTGTCATTTAGTGG + Intronic
1108123653 13:47217140-47217162 TAACCTAGTCTGTTACTTAGAGG - Intergenic
1108143859 13:47455933-47455955 ATTCCTAGTCTGCAACTTAGTGG + Intergenic
1111973015 13:94936726-94936748 AAACCCAGACATTCACTTAGAGG + Intergenic
1113651052 13:112034506-112034528 AATCCCAGGCTCTTACCTAGGGG + Intergenic
1114155181 14:20094585-20094607 AATCCCAGTCTCTCATTGATGGG - Intergenic
1116955272 14:50916907-50916929 AATCCCAGTCAATCCCTCAGTGG + Intronic
1124057130 15:26251873-26251895 AATCTCTGTCTTTCAATTAGAGG + Intergenic
1127272615 15:57414943-57414965 AATCCCATTCCACCACTTAGTGG + Intronic
1128635853 15:69302007-69302029 AGCCCCAGTCTGTCTCTCAGCGG + Intronic
1131747648 15:95466554-95466576 AATCACAGTCTGTCACTCCCTGG + Intergenic
1143878448 17:10011493-10011515 AGTCCCAGCCGGTCACTTAGTGG - Intronic
1145825939 17:27877401-27877423 AATCCCAGTCTGTCACTTAGTGG - Intronic
1146527871 17:33582185-33582207 AATAGGAGACTGTCACTTAGGGG + Intronic
1147601600 17:41749680-41749702 AATCTCACTCTGTCCCCTAGTGG + Intergenic
1147615793 17:41826645-41826667 AATCTCACTCTGTCCCCTAGTGG - Intronic
1148031093 17:44621576-44621598 AAACCCAGTCAGTCACTGACTGG + Intergenic
1148964849 17:51426271-51426293 AAACCCGTTCTGTCACTTATTGG + Intergenic
1150217697 17:63479497-63479519 AAACCCAGACAGACACTTAGCGG - Intergenic
1155518801 18:26648932-26648954 AAAAACAGTCTGGCACTTAGAGG + Intronic
1155583722 18:27341030-27341052 AATCTCAGTCTTTCAATGAGAGG - Intergenic
1156569061 18:38232137-38232159 AATCCCAGTAAGTTACTTTGTGG - Intergenic
1157283683 18:46362497-46362519 AAGCCCTCTCTGTCACTCAGGGG + Intronic
1161512986 19:4682170-4682192 AATCCCATGCAGTCACCTAGGGG - Intronic
1166854165 19:45774726-45774748 AAGCCCAGTCTGTGACTCTGAGG + Intronic
1202714035 1_KI270714v1_random:32624-32646 AGTCCCAGTAGGTCACTTCGTGG + Intergenic
930731070 2:54728530-54728552 AATCCCACTCTGCCATTTACCGG + Intronic
930847983 2:55925773-55925795 AGTCTCACTCTGTCACTCAGAGG - Intergenic
931217921 2:60263639-60263661 ATATCCAGTCTGCCACTTAGAGG - Intergenic
931336138 2:61345975-61345997 AATGTGATTCTGTCACTTAGTGG - Intronic
932137064 2:69240745-69240767 AATCCCACTCTGCCACTTACTGG + Intronic
933501150 2:83113178-83113200 AATCACAGTCTGTCAAGTAAAGG + Intergenic
934898957 2:98141932-98141954 AATTCAAATCTGCCACTTAGGGG - Intronic
936773988 2:115949983-115950005 AATCCCATTCTGCCACTTTATGG - Intergenic
937327667 2:121001223-121001245 AATCCCCATCTGCCACTCAGTGG - Intergenic
937957880 2:127432295-127432317 AATCCCAGTATGTCTTTTTGTGG + Intergenic
939401038 2:141694175-141694197 AATCCCAATATGTCATTTTGTGG - Intronic
941674687 2:168330920-168330942 AATATCAGTCTTTCACTTACAGG - Intergenic
942915704 2:181304090-181304112 AATCCTATTCTGCCACTTTGTGG - Intergenic
943204846 2:184881275-184881297 AAACCAAGTCTGTCACTCACTGG + Intronic
945827130 2:214735603-214735625 ATTCCCATTCTGCCACTTAATGG - Intronic
947610211 2:231520485-231520507 AAGCCCAGTCTCCCACTTACAGG - Intergenic
1171523254 20:25791679-25791701 AATCTCACTCTGTCACTCAGTGG - Intronic
1171553572 20:26064204-26064226 AATCTCACTCTGTCACTCAGTGG + Intergenic
1172184538 20:33023178-33023200 TTTACCAGTCTGTCACTTTGGGG - Intronic
1173665677 20:44761504-44761526 ACTCCCAGTTTGTCACTGGGTGG - Intronic
1175607568 20:60323470-60323492 ATTCCCATTCTGACACTTACTGG + Intergenic
1178193083 21:30308817-30308839 ATTCCTGGCCTGTCACTTAGAGG + Intergenic
1180645928 22:17339023-17339045 AATCCCATTCTGTCTCCTGGAGG + Intergenic
1181279322 22:21707566-21707588 AATCCCAGAATGCCACTTAAGGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949274172 3:2258349-2258371 AAGCCCAGTCTATCACTGATGGG - Intronic
951144965 3:19215739-19215761 AATACCAGTCTTTCATTTATTGG - Intronic
951252049 3:20405215-20405237 TATCTAAGTCTGTCACTTTGGGG + Intergenic
952505156 3:34000476-34000498 AATCACAGTGTGTCTCTGAGAGG - Intergenic
954139538 3:48597765-48597787 AAGCCCAGCCTGGCCCTTAGAGG - Intergenic
956200436 3:66700073-66700095 AATCCCAGACTCTCACTTTCTGG - Intergenic
967122185 3:186391953-186391975 AAATCCAGTTTGTCACTTATTGG + Intergenic
967594173 3:191311093-191311115 GATCCCAGTCTGTTGCTCAGTGG - Intronic
968794211 4:2691540-2691562 AGCCCCTGGCTGTCACTTAGGGG + Intronic
969783814 4:9435493-9435515 TAACCCAGTCTATCACTGAGGGG + Intergenic
973222348 4:47742890-47742912 AATTCTATTCTGTCAATTAGAGG + Intronic
973261741 4:48172122-48172144 AATCACAGTGCCTCACTTAGAGG + Intronic
973638548 4:52881859-52881881 AAACAGAGTCTGCCACTTAGTGG - Intronic
981036925 4:140180409-140180431 AATCTCACTCTGTCACCCAGTGG - Intergenic
981385909 4:144130369-144130391 AATCCAGGTCTGCCACTTGGTGG - Intronic
986494511 5:8329075-8329097 AATCCTAGGCTGTAAGTTAGAGG - Intergenic
988041481 5:25893604-25893626 AATCCCAGTCAGTCACCTGCAGG - Intergenic
990267532 5:54093605-54093627 AATCCAAGTCAGTCATTTAATGG - Intronic
991905124 5:71502212-71502234 AATCTCGCTCTGTCACGTAGTGG + Intronic
991932082 5:71763427-71763449 AATGCCAATATGTCACTTGGAGG + Intergenic
997396999 5:133569368-133569390 AAAGCCAGCCTGTCACTTAATGG - Intronic
998408155 5:141886360-141886382 AATCCCAGTCCATCCATTAGGGG + Intergenic
999308930 5:150538976-150538998 ATTCCCACTCTGTTACTTTGAGG + Intronic
999710495 5:154314246-154314268 AATCCATGTCTGTCACTTAGTGG - Intronic
1001117797 5:168954208-168954230 ATTCCCAGTTTGTCGCTAAGTGG - Intronic
1004661729 6:17716673-17716695 AAACCCAGAGTGTCACTTACTGG + Intergenic
1005210721 6:23458446-23458468 ATTCCCCCTCTTTCACTTAGTGG - Intergenic
1010415827 6:75610321-75610343 ATTAACAGTCTGTGACTTAGTGG - Intronic
1011485459 6:87836357-87836379 AATCACAGTATATCACTTAGAGG - Intergenic
1011922056 6:92590171-92590193 ATTCCCATTTTGTCACTTACTGG + Intergenic
1015039310 6:128697656-128697678 AATCCTAGACTGGCACTTTGAGG - Intergenic
1016379168 6:143456145-143456167 AATCCCAGTCTTTCATATTGAGG + Intronic
1017402060 6:154075831-154075853 AATCCCAGTCTGTCATTTACTGG + Intronic
1018662320 6:166099541-166099563 TATACCAGTCTGTCACCTGGGGG + Intergenic
1020882404 7:13778648-13778670 AATCTGATTCTGTCACTTATTGG - Intergenic
1025742718 7:64212253-64212275 AAACCCAGACTGCCACTTACTGG + Intronic
1029192350 7:98780894-98780916 AGTCCCAGTCCCCCACTTAGAGG + Intergenic
1030162123 7:106519677-106519699 AATCAGAGTCTGTCTCCTAGTGG + Intergenic
1031420534 7:121546119-121546141 AGCCCAAGTCTGTCACTTATTGG - Intergenic
1032329014 7:130960024-130960046 ATTTCCACTCTGTCACCTAGGGG + Intergenic
1036388021 8:8298573-8298595 AATCCCATCCAGTCCCTTAGAGG + Intergenic
1038018542 8:23534359-23534381 AATTCCAGTCTTTGACTTACTGG + Intronic
1039269072 8:35861007-35861029 AATCCAAGGCTGGCAATTAGTGG - Intergenic
1039771383 8:40691005-40691027 AATCCAAGGCTCTCACTAAGTGG - Intronic
1044888866 8:96810422-96810444 AATCCCAGTCTCTCACTTAGTGG + Intronic
1046165316 8:110426539-110426561 AATGACAGTCTCTGACTTAGTGG + Intergenic
1049466853 8:142755317-142755339 GATTCAAGTCTGTCACCTAGAGG + Intergenic
1050563011 9:6853812-6853834 AACCCCAATCTGTCACTTACTGG + Intronic
1053267531 9:36726079-36726101 CATCCCAGTCTGGCAGTGAGTGG - Intergenic
1055221528 9:73938756-73938778 AATACAGGTCTGACACTTAGGGG - Intergenic
1057772292 9:97979337-97979359 AATCCCACTCTACCACTTACTGG - Intergenic
1186378685 X:9034215-9034237 AACCACGGGCTGTCACTTAGGGG - Intronic
1186657646 X:11632518-11632540 ATTCCAAGTCTCTAACTTAGAGG - Intronic
1187075749 X:15932753-15932775 ATTCCCACTCTGTTACTTACAGG + Intergenic
1189335016 X:40165815-40165837 AGTCTCACTCTGTCACTTAGTGG + Intronic
1190995977 X:55609627-55609649 ATTCCCTGTCTGTCACACAGAGG + Intergenic
1197251786 X:124224569-124224591 AATCTCACTCTATCAGTTAGTGG + Intronic