ID: 1145825994

View in Genome Browser
Species Human (GRCh38)
Location 17:27877723-27877745
Sequence CCGTGGGCCCCTGCATGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145825984_1145825994 15 Left 1145825984 17:27877685-27877707 CCTGTGTGCACAGTGCTGTGTGC 0: 1
1: 0
2: 1
3: 35
4: 298
Right 1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG 0: 1
1: 0
2: 2
3: 15
4: 166
1145825983_1145825994 16 Left 1145825983 17:27877684-27877706 CCCTGTGTGCACAGTGCTGTGTG 0: 1
1: 0
2: 3
3: 40
4: 317
Right 1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG 0: 1
1: 0
2: 2
3: 15
4: 166
1145825982_1145825994 17 Left 1145825982 17:27877683-27877705 CCCCTGTGTGCACAGTGCTGTGT 0: 1
1: 0
2: 5
3: 37
4: 389
Right 1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG 0: 1
1: 0
2: 2
3: 15
4: 166
1145825987_1145825994 -10 Left 1145825987 17:27877710-27877732 CCTGCCTCCCCTACCGTGGGCCC 0: 1
1: 0
2: 0
3: 42
4: 356
Right 1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG 0: 1
1: 0
2: 2
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145825994 Original CRISPR CCGTGGGCCCCTGCATGACC GGG Intronic
900146377 1:1160660-1160682 CCGTGGGCCCCAGCGACACCTGG + Intergenic
900603760 1:3514888-3514910 GCCTGGGCCGCTGCCTGACCTGG - Intronic
901738161 1:11325379-11325401 CCCCAGGCCCCTGCATGACTGGG - Intergenic
902512676 1:16974853-16974875 CCCTCGGGCCCTGCCTGACCTGG - Exonic
915730018 1:158046656-158046678 CTGTGGGGTCCTGCAAGACCAGG + Intronic
919654370 1:200182994-200183016 CCTTGGGTCCCTGAATGGCCTGG + Intergenic
919808679 1:201396013-201396035 CCCTGGGCCCCAGCCTGTCCTGG - Intronic
920340367 1:205271817-205271839 CCGTGGAGTCCTGCCTGACCCGG + Exonic
922423610 1:225475176-225475198 CCCTGGGCCCCGGCAGAACCCGG + Intergenic
924744304 1:246818225-246818247 CCCTCGGGCCCTGCCTGACCTGG + Intergenic
924941582 1:248815887-248815909 CCGTGTGGCCCTGCATGGCATGG + Intronic
1063087622 10:2833778-2833800 TTGTGGGCCACTGCATGTCCTGG + Intergenic
1067176842 10:43956117-43956139 CCGTGGGACTCAGCATGAACAGG - Intergenic
1074078711 10:110151468-110151490 CCGTGGACCCCTCCAGCACCAGG - Intergenic
1076995042 11:293705-293727 CCCAGGGCCCCGCCATGACCTGG + Exonic
1077069225 11:660388-660410 CAGGGGGACCCTGCCTGACCTGG - Intronic
1077180131 11:1208560-1208582 CCCAGGGCCCCTGCAAGAACTGG - Intergenic
1080678379 11:34449263-34449285 CCGTGGGCCCCTTCTTGTTCAGG + Exonic
1081965301 11:47165627-47165649 CCGTGGACTCCTGCCTCACCGGG - Intronic
1084636644 11:70397733-70397755 CTATCGGCCTCTGCATGACCTGG + Intergenic
1088086030 11:105981629-105981651 ACATGAGCCCCTTCATGACCTGG + Exonic
1089821551 11:121231853-121231875 CCTTGAACCCCTGCATGACAAGG - Intergenic
1090974150 11:131667596-131667618 CTCTGGGTCCCTCCATGACCAGG - Intronic
1092335448 12:7628817-7628839 CCGCGGGCACCTGCAAGACGGGG + Intergenic
1092505564 12:9095640-9095662 CCCTGGGCCTTTGAATGACCAGG - Exonic
1096215011 12:49793772-49793794 CTGTGGGCCCCGGAATGGCCTGG - Exonic
1100980231 12:100157539-100157561 CCATGGCCCCCTGCAGGGCCTGG + Intergenic
1101115725 12:101529583-101529605 CCATGGGGCCTTGCATGACCTGG + Intergenic
1103904687 12:124321315-124321337 CCTTGGGCCCATGCAGGACCTGG - Intergenic
1104751958 12:131245509-131245531 CCCTGGGCCCCTGCAGCACCAGG - Intergenic
1107958874 13:45542023-45542045 CCATGGGGCCCTGCAAGAGCTGG + Intronic
1113634574 13:111910667-111910689 GCCTGGGCCCCTGCAGGAGCAGG - Intergenic
1117611159 14:57484727-57484749 CTGTCAGGCCCTGCATGACCTGG - Intronic
1117783587 14:59259404-59259426 CCGTAGGACCCTGCATGAGCTGG + Intronic
1119434237 14:74587404-74587426 GCCTGGACCCCTGCATCACCTGG - Intronic
1122632451 14:103113137-103113159 CCTGGGGCTCCTGCATGTCCTGG + Intergenic
1122992037 14:105241057-105241079 CCGTTGGCCTCTGCGTGTCCTGG - Intronic
1125609474 15:40960783-40960805 CCGTGGACCCCAGCATGGCCAGG + Intergenic
1129185714 15:73905064-73905086 CCGTGGGCCCCAGCTAGGCCTGG - Intergenic
1129239182 15:74241536-74241558 CCGTGGGGCCCTCCAGGAGCTGG - Intronic
1129516507 15:76160660-76160682 CCCAGGGCCCCTGCAGGACCAGG - Intronic
1130276172 15:82477405-82477427 CCATGGCCCCCTGCAGGGCCCGG + Intergenic
1130468531 15:84204798-84204820 CCATGGCCCCCTGCAGGGCCCGG + Intergenic
1130485221 15:84394964-84394986 CCATGGCCCCCTGCAGGGCCTGG - Intergenic
1130495733 15:84468744-84468766 CCATGGCCCCCTGCAGGGCCCGG - Intergenic
1130590824 15:85209397-85209419 CCATGGCCCCCTGCAGGGCCCGG + Intergenic
1131188540 15:90294816-90294838 CCTTGGCCCCCTGCAGGGCCCGG - Intronic
1132252224 15:100342231-100342253 CCGTGGGACCCTGGAAGAGCTGG + Intergenic
1132604212 16:787006-787028 CGGTGGGTCCCTGCCTGCCCAGG + Intronic
1132625188 16:888209-888231 CCGTGGGTCCCTGCCCGCCCAGG + Intronic
1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG + Intronic
1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG + Intergenic
1135636352 16:24078820-24078842 CTGTAGGACCCTGAATGACCAGG + Intronic
1135824363 16:25713591-25713613 CCTTGGTTCCTTGCATGACCTGG + Intronic
1137466686 16:48716063-48716085 CTGTGGGTCCCTGCAAGACCTGG - Intergenic
1139355280 16:66364002-66364024 CCGTTGCTGCCTGCATGACCTGG - Intergenic
1139582108 16:67879950-67879972 CTGTGGACCCCTCCTTGACCAGG + Exonic
1140357560 16:74319329-74319351 TCACGGGTCCCTGCATGACCTGG + Intergenic
1141659640 16:85435136-85435158 GCCTGGGCCTCTGCCTGACCTGG - Intergenic
1141842182 16:86580107-86580129 CTGCGGGCCCTTGCATGCCCGGG - Exonic
1141898864 16:86977170-86977192 CAGTTGGCCCCTTCATGTCCTGG - Intergenic
1142200872 16:88760610-88760632 CCTCGGGCCCCTGCCTGTCCTGG - Intronic
1142200910 16:88760732-88760754 CCTCGGGCCCCTGCCTGTCCCGG - Intronic
1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG + Intronic
1144851395 17:18245872-18245894 CCCAGGGCCCCTGCCTGCCCTGG + Intronic
1145064212 17:19751040-19751062 CTGTGAGCCCCTGCCTGGCCTGG + Intergenic
1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG + Intronic
1146255666 17:31390669-31390691 CCTCGGGGCCCTGCAGGACCCGG - Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1152228147 17:79102140-79102162 CCGTGTGCCCCTGGAGGACGAGG + Intronic
1152600829 17:81261291-81261313 CCGTGGCCCCGTGAATGACTGGG - Intronic
1155369205 18:25080104-25080126 CCTTGGGCCCCTCCATGTCTGGG - Intronic
1157444042 18:47731539-47731561 CCCTGGGCTCCTTCAGGACCTGG - Intergenic
1157560169 18:48640022-48640044 CAGAGAGCCCCTGCATGACAGGG - Intronic
1159121423 18:64175895-64175917 CTGTGTGCCCCAGCATGCCCTGG + Intergenic
1160930032 19:1566268-1566290 CCGTGGGTCCCCACATGAGCTGG + Intronic
1161226461 19:3148784-3148806 CCCTGGGCCCCTGCCTGCCCTGG - Intronic
1161226469 19:3148801-3148823 CCCTGGGCCCCTGCCTGCCCTGG - Intronic
1161356963 19:3824540-3824562 CTGTGCTCCCCTGCATGCCCTGG - Intronic
1162467389 19:10850401-10850423 CCGTGGGGGCCTGCAGGAGCTGG - Exonic
1167117841 19:47498345-47498367 CCAGGGGCCCCTGCCTGCCCTGG - Intronic
1167745782 19:51351115-51351137 CCCTGGGCAGCTGCATGAACAGG + Intronic
925592747 2:5526434-5526456 CCCTGGGCCCCTGCATTGGCAGG + Intergenic
926192376 2:10738522-10738544 CCGTGGGTCCCTGAAGGACCGGG - Intronic
926474731 2:13308385-13308407 CCGTGGGCTCCTGCGCGGCCCGG - Intergenic
927850417 2:26495125-26495147 CCCTGGACCCCTGCGGGACCAGG - Intronic
929779256 2:44947142-44947164 CAGTGGGACCTTGCATGTCCAGG + Intergenic
930837762 2:55812563-55812585 CTTTGTGCCCCTGGATGACCTGG - Intergenic
932421741 2:71605436-71605458 TCGTGGGTCCCTGAATGCCCAGG + Intronic
934729919 2:96650001-96650023 CCATGGGCCCCTTCATGCTCAGG - Intergenic
937997850 2:127708628-127708650 CCATCGGCCCCTGCATCTCCTGG + Intronic
938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG + Intergenic
942653702 2:178194257-178194279 CTGTGGGACCCCGCGTGACCAGG + Intergenic
947472127 2:230410196-230410218 CCCAGGGCCACTTCATGACCTGG + Intergenic
947736070 2:232456193-232456215 CCCAGGGCCCCTGCATGTCTTGG - Exonic
948273628 2:236692086-236692108 CCGAGGGCCCATGCTTGCCCCGG - Intergenic
948299241 2:236889625-236889647 CTGGGGGCCCCTGGATAACCCGG + Intergenic
1168914285 20:1473735-1473757 CTGTAGGGCCCTGCATGAGCTGG - Intronic
1169009349 20:2237399-2237421 CCTTGGGCCCCCGGATGAGCAGG - Intergenic
1169519015 20:6351230-6351252 CAGTGGGAACCTGTATGACCCGG + Intergenic
1171395284 20:24829184-24829206 CTCTGGGGCCCTGCATCACCTGG - Intergenic
1171432408 20:25091361-25091383 CCTGGGGCCCCTGCATGCCAGGG + Intergenic
1175424179 20:58853830-58853852 CCGGGGACCCCTGCAGCACCTGG - Exonic
1176041246 20:63067028-63067050 CCGTGGTCCCCTGCTGCACCAGG + Intergenic
1176044751 20:63086774-63086796 CCGTGGGCCAGTGCAGGGCCTGG + Intergenic
1176097442 20:63350748-63350770 CCGTGGGCACCTACAACACCAGG - Exonic
1179218818 21:39388892-39388914 CAGAGGGGCCCCGCATGACCTGG - Intronic
1180099457 21:45577796-45577818 CTGGGGGCCCCTGAAGGACCTGG + Intergenic
1181469409 22:23128550-23128572 CCCAGGGCCCCTGCAGGGCCAGG + Intronic
1181477862 22:23179964-23179986 TCGTGGGCATCTGCAAGACCAGG - Intronic
1183537736 22:38412991-38413013 CCGCGGGCCCCTGCGGGCCCCGG - Intergenic
1184273991 22:43399979-43400001 CCGCGGTCACCTGCCTGACCAGG + Intergenic
1184423900 22:44397738-44397760 CCGTGGGCTCCTCCATGCCACGG - Intergenic
1184648383 22:45908280-45908302 CACTGGGTCCCTGCATGCCCGGG + Intergenic
1184663733 22:45977011-45977033 CCGTGGACCCCTGCAAGCGCGGG + Exonic
1184682558 22:46080017-46080039 CTGTGGGCGCCTGCCTGGCCGGG - Intronic
1185164868 22:49255357-49255379 CCGGGGGCCCCTCCCTGCCCTGG + Intergenic
1185310012 22:50149111-50149133 CTGTGGCCGCCTGCATGGCCAGG + Intronic
1185398857 22:50605779-50605801 CCCTGTGCCCCTGCCTGACCTGG + Intronic
953563315 3:44011644-44011666 CCGTGGTCCCCTGCAATGCCTGG + Intergenic
954488064 3:50873210-50873232 CCCTGGGGCCCTGAATAACCAGG - Intronic
954630448 3:52045061-52045083 CCGTGGGCCCACGCATGCCCGGG + Intergenic
954895610 3:53972615-53972637 CCGTGAGGCCCTGCCTGATCTGG + Intergenic
956420178 3:69079867-69079889 CGGAGGGCCCCTGCAGGAGCTGG + Intronic
956751990 3:72350906-72350928 CCGTGGCTCCCCGCATGTCCTGG + Intergenic
957072712 3:75579298-75579320 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
959117009 3:102190485-102190507 CCCTGGGTGCCTGCAGGACCAGG + Intronic
961862203 3:129926049-129926071 ATGTGGGCCCCTGCAGGAGCTGG - Intergenic
961873007 3:130002126-130002148 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
962239887 3:133743458-133743480 TCCTTGGCCCCTGCATGTCCTGG + Intergenic
963068679 3:141284213-141284235 ACCTGGGGCCCTGAATGACCAGG - Intronic
968491523 4:892940-892962 CCCTGGGCTCCTGCAGGAGCAGG - Intronic
969243549 4:5917881-5917903 GCCTGGGCCCCTGCTTGGCCTGG - Intronic
969796835 4:9533277-9533299 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
975035344 4:69673250-69673272 CAGTGTGCTCCTGAATGACCAGG + Intergenic
979769703 4:124507799-124507821 CCTTGAGCCTCTGCATGAGCAGG + Intergenic
990988891 5:61665946-61665968 GGGTGGGTCCCAGCATGACCTGG + Intronic
995827033 5:116312042-116312064 TGGTGGGCCCCTGCAGGCCCAGG - Intronic
997713987 5:136028847-136028869 CCGTGCGCCCCTGGCTGCCCTGG - Intergenic
998056535 5:139083015-139083037 CCTTGAGCCCCTGCAGGGCCTGG - Intronic
1002422855 5:179158650-179158672 CCGGGGCCCCTTGCATGGCCAGG + Intronic
1007614325 6:43171496-43171518 CCCGGGGCCCCTGCACGCCCGGG - Exonic
1014872669 6:126615172-126615194 CCTTGGGTGCCTACATGACCAGG - Intergenic
1018892366 6:167990879-167990901 CCGCGCGCCCCTGGATCACCTGG + Intergenic
1018921500 6:168179157-168179179 TCCTGGGCCCCTGCAGTACCTGG + Intergenic
1019180647 6:170185742-170185764 CCGTGGATCGCTGCATGAGCCGG - Intergenic
1019621797 7:1996142-1996164 CCGGGGGACCCTGCATGCCCAGG - Intronic
1023037685 7:36147570-36147592 CCGTGGTCCCCTGCTAGCCCTGG - Intergenic
1023052723 7:36267316-36267338 ATGGGGGCCCCTGCATGGCCAGG + Intronic
1025093672 7:56082046-56082068 CCCTGGGCCCTCGCATGTCCAGG - Exonic
1027173498 7:75889036-75889058 CCCTGGTCACCTGCCTGACCTGG - Intergenic
1031035234 7:116781275-116781297 CCATGTGACCCTGCATGACAGGG + Intronic
1033472225 7:141660364-141660386 CCCTGGCCCTCTGCATGAGCAGG + Exonic
1033627832 7:143128303-143128325 CCCTTGGCCCCTACATCACCAGG + Intergenic
1033824980 7:145178552-145178574 CTGTGGGCCCCTGGAGGTCCAGG + Intergenic
1036242731 8:7092976-7092998 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
1036258074 8:7221052-7221074 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036310124 8:7679648-7679670 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG + Intergenic
1036829998 8:12014168-12014190 ACGTGGGCCCCTGAGTCACCGGG - Intronic
1036891544 8:12600498-12600520 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036899086 8:12658462-12658484 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
1039965632 8:42281591-42281613 CCCTGGGCCCCAGCATCGCCTGG - Intronic
1041107139 8:54454539-54454561 CCGTGGGCCCCTGAGTGACCAGG - Intergenic
1042392143 8:68248341-68248363 CCTTGGCCTCCTGCCTGACCTGG + Intergenic
1042765377 8:72315537-72315559 CCTTGGGACTCTTCATGACCTGG - Intergenic
1043438904 8:80259873-80259895 CCTTGGGCACCTGCAGGAGCAGG + Intergenic
1043982482 8:86658067-86658089 CCATGGCCCCCTGCAGGGCCGGG + Intronic
1045516459 8:102864344-102864366 CAGTCTGCACCTGCATGACCCGG - Exonic
1046676117 8:117110558-117110580 TCATGTGCCCCTGCATGCCCTGG - Intronic
1049593263 8:143472112-143472134 CCCTGGACCCCTGCCTGCCCTGG + Intronic
1049790825 8:144472080-144472102 CCCAGGGGCCCTGCATGACTTGG + Intronic
1058899598 9:109430779-109430801 CCGTGAAGCCCTCCATGACCTGG + Intronic
1060054301 9:120400656-120400678 CTGTGGGCCCCTGCTTGGCATGG + Intronic
1060148045 9:121268567-121268589 TGGTGGTCCCCTGCATGCCCGGG - Intronic
1060759375 9:126235013-126235035 CCCTGTGTCCCAGCATGACCTGG + Intergenic
1060932361 9:127497105-127497127 CCGTGGGCCCCGCCAGGCCCCGG + Intronic
1061062557 9:128257991-128258013 CCATGGCCCCCTGCAGGGCCCGG + Exonic
1061301876 9:129710163-129710185 CCATGGACCCCTGCCTGAGCTGG - Intronic
1062005372 9:134236094-134236116 CCCAGGGCCCCAGCATGTCCTGG - Intergenic
1203770686 EBV:48517-48539 CCGGGGGGCCCTGCCTGAGCCGG + Intergenic
1197729536 X:129797880-129797902 CCGTGGGCCTCTCCAGGGCCTGG + Intergenic
1198274738 X:135089857-135089879 CCGTGGACATCAGCATGACCTGG + Intergenic
1198972043 X:142292758-142292780 CCTTGCTCCTCTGCATGACCTGG + Intergenic