ID: 1145826007

View in Genome Browser
Species Human (GRCh38)
Location 17:27877757-27877779
Sequence CTGTGGCAGCACAGGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 8, 3: 69, 4: 526}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145825990_1145826007 16 Left 1145825990 17:27877718-27877740 CCCTACCGTGGGCCCCTGCATGA 0: 1
1: 0
2: 2
3: 5
4: 108
Right 1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 526
1145825991_1145826007 15 Left 1145825991 17:27877719-27877741 CCTACCGTGGGCCCCTGCATGAC 0: 1
1: 1
2: 2
3: 23
4: 155
Right 1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 526
1145825993_1145826007 11 Left 1145825993 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG 0: 1
1: 0
2: 2
3: 19
4: 206
Right 1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 526
1145825996_1145826007 3 Left 1145825996 17:27877731-27877753 CCCTGCATGACCGGGCTCACTAC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 526
1145825997_1145826007 2 Left 1145825997 17:27877732-27877754 CCTGCATGACCGGGCTCACTACC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 526
1145825989_1145826007 17 Left 1145825989 17:27877717-27877739 CCCCTACCGTGGGCCCCTGCATG 0: 1
1: 0
2: 3
3: 27
4: 181
Right 1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 526
1145825987_1145826007 24 Left 1145825987 17:27877710-27877732 CCTGCCTCCCCTACCGTGGGCCC 0: 1
1: 0
2: 0
3: 42
4: 356
Right 1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 526
1145825988_1145826007 20 Left 1145825988 17:27877714-27877736 CCTCCCCTACCGTGGGCCCCTGC 0: 1
1: 0
2: 7
3: 51
4: 478
Right 1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 526
1145825999_1145826007 -7 Left 1145825999 17:27877741-27877763 CCGGGCTCACTACCCTCTGTGGC 0: 1
1: 0
2: 0
3: 20
4: 189
Right 1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 526
1145825995_1145826007 4 Left 1145825995 17:27877730-27877752 CCCCTGCATGACCGGGCTCACTA 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145826007 Original CRISPR CTGTGGCAGCACAGGGGCTG GGG Intronic
900095582 1:938838-938860 CTGTGGCGGGACAGGGGCACAGG - Intronic
900117964 1:1036573-1036595 CTGGGGCAGCGCTGGGCCTGGGG + Intronic
900269725 1:1780911-1780933 CAATGGCAGCCCTGGGGCTGAGG - Intergenic
900430183 1:2597668-2597690 CTGTGGCTGCTCCAGGGCTGGGG - Intronic
900814555 1:4833445-4833467 CTGGGGCTGCACAGCTGCTGTGG - Intergenic
900987644 1:6082505-6082527 CTTTGGCACCAGAGGGACTGTGG - Intronic
901188029 1:7387525-7387547 CCCTGGCAGGACAGTGGCTGGGG - Intronic
901206759 1:7501970-7501992 CTGAGACTGCAGAGGGGCTGGGG + Intronic
901320860 1:8339169-8339191 CTGTGACACCAAAGGGGCTCAGG - Intronic
901460549 1:9388714-9388736 CTGGGGAAGCTCAGAGGCTGGGG + Intergenic
902077312 1:13798043-13798065 CAGGGGCAGCTCAGGAGCTGGGG + Intronic
902359709 1:15935746-15935768 CTCTGACTGCACAGGGGCTGTGG - Exonic
903277609 1:22231837-22231859 CTGTGACAGCACAGGGTCTGCGG - Intergenic
903389651 1:22954874-22954896 CTCTGGGAGCAGTGGGGCTGTGG - Intronic
903658700 1:24964147-24964169 CCCAGGCAGGACAGGGGCTGGGG + Intronic
903674916 1:25057529-25057551 CTGGGGCAGGTGAGGGGCTGGGG - Intergenic
904603887 1:31688690-31688712 CTGGGGCAGCACAGGGACGGAGG + Intronic
905276925 1:36824444-36824466 CTCTGGCAGCACAGGGCCTGGGG + Intronic
905798207 1:40827301-40827323 GGGAGGAAGCACAGGGGCTGTGG + Intronic
906517696 1:46449151-46449173 CTAAGGTAGCACAGAGGCTGGGG - Intergenic
907237676 1:53062865-53062887 CTGGGGCGGCACAGTGGCCGGGG - Intronic
907276771 1:53321210-53321232 TTGTGGGAGCTCAGGGCCTGAGG + Intronic
907305071 1:53508717-53508739 CTTTGGCAGCACAGGAGATTAGG - Intronic
907331821 1:53676612-53676634 CTGTGGCAGGGCTGGGGCTGGGG - Intronic
907389819 1:54150997-54151019 CTGTGGCCACAAAGGGGCTCTGG + Intronic
907421230 1:54348683-54348705 CTGTGCCAGCTTAGGGTCTGTGG + Intronic
907581071 1:55573207-55573229 ATGTGCCAGAGCAGGGGCTGGGG + Intergenic
908392767 1:63698645-63698667 CCGTGGAGACACAGGGGCTGAGG + Intergenic
908501018 1:64744626-64744648 CTGGGGCGGCCCGGGGGCTGCGG - Intergenic
910788072 1:91021905-91021927 CTGTGGCAGCGGCGGGACTGAGG - Intronic
911673281 1:100631265-100631287 CTGAGGCAGGAGAGAGGCTGAGG + Intergenic
912386351 1:109273028-109273050 GTGGGCCAGCACTGGGGCTGTGG + Intronic
912555164 1:110510767-110510789 CTGGGACAGCAGAGTGGCTGAGG - Intergenic
912810324 1:112789436-112789458 CTGGGTCAGCAAAGGAGCTGAGG - Intergenic
913113548 1:115677059-115677081 CTGAGTCTGCACAGAGGCTGTGG - Intronic
914917944 1:151829812-151829834 ATGTGTCAGCACAAGGGCAGGGG - Intronic
915268616 1:154735811-154735833 CTGCCTCAGCACAGGGCCTGAGG - Intronic
915551804 1:156639698-156639720 CTCTGGCATCACAGGCACTGAGG - Intergenic
916081095 1:161232884-161232906 CAGAGGCAGCACAGGGGCCAGGG + Exonic
916377555 1:164171920-164171942 CTGTTGGGGGACAGGGGCTGGGG + Intergenic
917285250 1:173416206-173416228 CAGTGGCAGCAGCTGGGCTGTGG + Intergenic
918458790 1:184754811-184754833 CGGTGGCAGCGCTGGCGCTGGGG - Exonic
918497415 1:185156530-185156552 CTGGGCCAGGGCAGGGGCTGGGG + Exonic
919826476 1:201506960-201506982 CTGCGACAGCCCCGGGGCTGCGG + Intronic
920053357 1:203176272-203176294 CTGTGGGAGCCCAGGGAATGTGG - Intergenic
920519746 1:206614431-206614453 CTTTTGCAGCACAGCTGCTGAGG + Intergenic
920540990 1:206777898-206777920 CTGTTGCAGCACAGCTTCTGAGG - Intergenic
922124893 1:222712459-222712481 CTGTGGCGGCAAATGGGCTTGGG - Exonic
922890957 1:229061777-229061799 CTCTGGCAGCAAAGGGGAGGTGG + Intergenic
923542783 1:234900623-234900645 CTGATGCAGCACAGGGCCTGGGG + Intergenic
924812108 1:247412065-247412087 ATGTGGCAGCACAGTGGGTGGGG + Intergenic
924873524 1:248075026-248075048 CTGGGGAATCTCAGGGGCTGGGG - Intronic
1062926638 10:1320942-1320964 CTGTGGCAGCACAGGGTCATTGG + Intronic
1062982027 10:1732732-1732754 CTGTAGCATTGCAGGGGCTGCGG + Intronic
1063116633 10:3076389-3076411 CTCAGGTAGCAGAGGGGCTGGGG - Intronic
1063964362 10:11335232-11335254 CAGAGGCAGAACAGGGCCTGCGG - Exonic
1064099612 10:12451948-12451970 CTGAAGCAGCACATGTGCTGGGG + Intronic
1064319947 10:14295666-14295688 CAGCTGCAGCACATGGGCTGTGG + Intronic
1065561491 10:26968414-26968436 CAGGGTGAGCACAGGGGCTGTGG - Intergenic
1066210707 10:33234893-33234915 CTGCAACAGCACAGGGGCAGTGG + Intronic
1066518005 10:36185236-36185258 TTGTGGAAGGACAGGTGCTGGGG + Intergenic
1066976193 10:42369875-42369897 CTGTGGAGGCACATGGGCTTTGG - Intergenic
1067008679 10:42690503-42690525 CTGTGGCAGGGCTGTGGCTGTGG - Intergenic
1067262775 10:44708821-44708843 ATGTGGCAGGATGGGGGCTGAGG - Intergenic
1067524373 10:47029332-47029354 CTGGGGCTGCACAGAGGCTGTGG - Intergenic
1067587571 10:47485008-47485030 ATGGGGCAGCTCCGGGGCTGGGG - Intergenic
1069157987 10:65053693-65053715 CTGAGGCGGCTGAGGGGCTGAGG - Intergenic
1069157992 10:65053710-65053732 CTGAGGCGGCTGAGGGGCTGAGG - Intergenic
1069157997 10:65053727-65053749 CTGAGGCGGCTGAGGGGCTGAGG - Intergenic
1069158037 10:65053863-65053885 CTGAGGCGGCTGAGGGGCTGAGG - Intergenic
1069158047 10:65053897-65053919 CTGAGGCGGCTGAGGGGCTGAGG - Intergenic
1069769830 10:70891177-70891199 CTGTGGCAGCACCCAGGCAGGGG + Intergenic
1069816852 10:71202173-71202195 TTGTGGTGGAACAGGGGCTGGGG - Intergenic
1071240345 10:83698237-83698259 CTGAGGAAGCAGAGGAGCTGAGG - Intergenic
1073028001 10:100502425-100502447 CTGTGGCACCAGATGGGCAGGGG + Exonic
1073442496 10:103560649-103560671 CTGGGCATGCACAGGGGCTGTGG + Intronic
1073510745 10:104041007-104041029 CTGTGGCAGGACAAGGGCTGAGG + Intronic
1074190155 10:111128575-111128597 ATGTGGCTGCAGAGGGGCTGAGG + Intergenic
1074871017 10:117576078-117576100 CTCTGGAAGCCCAGGGGCTGGGG + Intergenic
1075018502 10:118929043-118929065 CTGTGGTACCACTTGGGCTGGGG - Intergenic
1075334322 10:121597797-121597819 CTGTGGCTGCATAGGTGATGGGG - Intronic
1075454049 10:122573475-122573497 CTGTGGCAGCAGAGGACATGGGG + Intronic
1075995405 10:126872788-126872810 CTGTGGTTGCAAAGAGGCTGAGG - Intergenic
1076249469 10:128974002-128974024 CTGTGTCAGCCCTGGTGCTGGGG - Intergenic
1076288225 10:129322246-129322268 TTGTGGCAGCAAAGGGGATGAGG + Intergenic
1076708814 10:132319689-132319711 CTGTGGGAATGCAGGGGCTGAGG + Intronic
1076757215 10:132578842-132578864 GGGTGCCAGCAGAGGGGCTGCGG + Intronic
1076791266 10:132777956-132777978 CTGAGCCAGCACCTGGGCTGGGG + Intronic
1076797353 10:132804825-132804847 CTCTGGAAACACAGGGGCTCTGG - Intergenic
1076806108 10:132859656-132859678 CTGTGGCTGCTCCGGGGCGGCGG - Intronic
1076994433 11:291201-291223 TTGGGGAAGCACAGGGACTGTGG + Intronic
1077106876 11:845995-846017 CTGGGGCCCCGCAGGGGCTGAGG + Intronic
1077177999 11:1199288-1199310 CTCTGGAAGCCCACGGGCTGGGG + Intronic
1077249753 11:1555726-1555748 CTGTGGCTGGACTGGGGCTCTGG + Exonic
1077482967 11:2825170-2825192 CTGCGGCGGGACTGGGGCTGGGG + Intronic
1077600889 11:3573717-3573739 CTGTGGAAGGATAGGGGCTTTGG + Intergenic
1077916581 11:6615546-6615568 CTGTGGTGACATAGGGGCTGAGG + Exonic
1077953824 11:6991388-6991410 CTGCGGCAGGGCTGGGGCTGTGG + Intergenic
1078143416 11:8707559-8707581 CACTGCCAGCACAGGAGCTGGGG + Intronic
1078432455 11:11298450-11298472 TTCTGGCAGCTCAGGGCCTGTGG + Intronic
1079083617 11:17430356-17430378 CTGTGAGGGCTCAGGGGCTGTGG + Intronic
1081286029 11:41271185-41271207 CTGTGGAAGCACAAGAACTGGGG - Intronic
1083616377 11:64028544-64028566 CGGAGGGAGCAGAGGGGCTGAGG - Intronic
1083742154 11:64716725-64716747 CTCTGGGGGCACAGGGACTGCGG + Intronic
1083775550 11:64892936-64892958 TTGGGGCAGCACAGGCCCTGGGG - Intergenic
1084020445 11:66414119-66414141 ACGAGGAAGCACAGGGGCTGGGG + Intergenic
1084525719 11:69696894-69696916 TGGAGGCAGCTCAGGGGCTGTGG - Intergenic
1084942218 11:72618822-72618844 CAGTGGGGCCACAGGGGCTGAGG + Intronic
1084962920 11:72726700-72726722 CGGGGGCAGCACAGGGTCTGGGG + Exonic
1085602473 11:77867715-77867737 CTGTGTCAGCAAAGGGGATATGG - Intronic
1087011889 11:93522385-93522407 CTTTCTCAGCAGAGGGGCTGTGG + Intronic
1089358319 11:117870213-117870235 GCCTGCCAGCACAGGGGCTGAGG + Intronic
1089455143 11:118621545-118621567 CTGTGGCTGGCCCGGGGCTGAGG - Intronic
1089603894 11:119630650-119630672 CTGTGGAAGCACAGGGCCAAAGG - Intronic
1090306536 11:125696233-125696255 TTGTGCCAGAAAAGGGGCTGTGG - Intergenic
1090309359 11:125721155-125721177 CTGTGGGAGCACAGGGAGAGAGG - Intergenic
1091113997 11:132996907-132996929 CTGTAGCAGCACAGGTCCTAAGG + Intronic
1091147145 11:133289876-133289898 CTGGGTCTGCACAGGTGCTGGGG + Intronic
1092192295 12:6529680-6529702 CTGTGGCATCCCTGGGACTGGGG + Intronic
1092427044 12:8383076-8383098 CTGTGGAAGGATAGGGGCTTTGG + Intergenic
1094473382 12:30823354-30823376 CTGTGACAGCACAGGAGACGAGG - Intergenic
1095589487 12:43887831-43887853 GTGTGGAAGGAAAGGGGCTGTGG + Intronic
1095954617 12:47798946-47798968 GTGTGTCTGCACAGGGCCTGGGG + Exonic
1096460591 12:51819815-51819837 CTCTGGAGGCCCAGGGGCTGAGG - Intergenic
1096722202 12:53531744-53531766 CTGTGGCTGGGCAGGGGATGGGG + Exonic
1097269268 12:57764416-57764438 CTGGGACAGAACAGTGGCTGAGG + Exonic
1097650608 12:62292938-62292960 ATGTGGAAGCACAAGGGCTGAGG + Intronic
1097999467 12:65924409-65924431 CTGAGGCAACACAGAGGCAGAGG - Intronic
1098217620 12:68236798-68236820 CTGTAGCAGGTTAGGGGCTGAGG + Intergenic
1100221927 12:92514527-92514549 CTGTGGCAGCACTGAGTCTGTGG - Intergenic
1100454767 12:94741546-94741568 CTGTGGGAGCTCAGGAGCAGGGG + Intergenic
1101781701 12:107843988-107844010 CTGTGGCGGCACAGGGGTGGGGG - Intergenic
1102454373 12:113062795-113062817 CTCTGGCCCCACAGGGGCTGCGG + Intronic
1102699492 12:114826551-114826573 CTGTGGCACCAAAGGAGCTAAGG + Intergenic
1102725448 12:115060382-115060404 CTATGGTATCACAGGAGCTGGGG + Intergenic
1102987832 12:117292931-117292953 CCTTGGCAGCACAGGGGAGGTGG + Intronic
1103047086 12:117745149-117745171 CTGTGGCAGCATTGGGGTAGGGG - Intronic
1103536820 12:121639000-121639022 GTGTGTCAGCCCTGGGGCTGGGG + Intronic
1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG + Intergenic
1104873904 12:132019708-132019730 CTATTACAGCACAAGGGCTGAGG - Intronic
1104875321 12:132029759-132029781 CTGTGGCTGTACAGGGGTGGCGG - Exonic
1104891020 12:132140247-132140269 CCGTGGCAGCACCGGCCCTGCGG + Intronic
1104994073 12:132643185-132643207 CCATGGCAGCACATTGGCTGGGG - Intronic
1105541572 13:21321015-21321037 CTCAGGCAGGCCAGGGGCTGAGG - Intergenic
1105937736 13:25117601-25117623 CGGGGGCAGCACTGGGGCGGGGG - Intergenic
1106599637 13:31176602-31176624 CTGTGGCAAAACAGGACCTGGGG - Intergenic
1106642293 13:31597205-31597227 ATGTGGAAGGACAGGGGCTGTGG + Intergenic
1107034354 13:35884910-35884932 ATTGGGCAGCACAGAGGCTGTGG - Intronic
1107301163 13:38967139-38967161 ATGTGGCAACATGGGGGCTGGGG - Intronic
1107491009 13:40879871-40879893 CTGTGGAGGCACAGGTGCTGTGG + Intergenic
1108696484 13:52906744-52906766 CTGTGGCAACACATGCTCTGGGG - Intergenic
1109935860 13:69283313-69283335 GATTGGCAGCACTGGGGCTGAGG - Intergenic
1111787997 13:92815695-92815717 CTGTGGCTGTACAAGGGGTGGGG + Intronic
1113004845 13:105688726-105688748 CTGTGGGAGCAAAGGAGCTGGGG + Intergenic
1113342573 13:109441258-109441280 GTGTGGCAGCTCTGGAGCTGAGG + Intergenic
1113938720 13:114007782-114007804 CTGTGGCAGTGCCGGGGCTGGGG - Intronic
1114339021 14:21723754-21723776 CTGTGTCAGCACAGGGCTTTTGG - Intergenic
1114364101 14:22008283-22008305 CTGTGTCAGCACAGGTGGTTTGG + Intergenic
1114556222 14:23563910-23563932 CTGGGGAAGCAGAGGGCCTGAGG - Intronic
1115553777 14:34527784-34527806 CAGTGGCTGCCAAGGGGCTGAGG + Intronic
1115949809 14:38708265-38708287 CTGTAGCTACCCAGGGGCTGTGG - Intergenic
1117955442 14:61120060-61120082 CTGTGGAGGCTCAGGTGCTGTGG + Intergenic
1118005551 14:61561850-61561872 CTGAGGAAGCACAGGGGCTGTGG + Intronic
1119027474 14:71165523-71165545 TTCAGCCAGCACAGGGGCTGCGG - Intergenic
1119087296 14:71750234-71750256 CTCTGACAGCACAGAAGCTGTGG - Intergenic
1119322808 14:73741667-73741689 CTCCAGGAGCACAGGGGCTGGGG - Intronic
1119509080 14:75197081-75197103 AGGTGGCACCACAGGGACTGTGG - Intergenic
1119665194 14:76480367-76480389 CTGGGGCAGCAGAGGGGTGGGGG + Intronic
1120846580 14:89131481-89131503 CTGTGGTACCACAGAGGGTGGGG - Intronic
1121108536 14:91296450-91296472 CTGTGACAGCACAGCCCCTGGGG + Intronic
1121309199 14:92925924-92925946 CTGTGCCTGCAAAGGTGCTGTGG - Intronic
1121449476 14:93998263-93998285 CTGGGGAAGCACTGGGGCTGGGG - Intergenic
1121508110 14:94491862-94491884 TTGGGGGAGAACAGGGGCTGGGG + Intronic
1121642803 14:95497139-95497161 GTGTGGGGGGACAGGGGCTGGGG - Intergenic
1122695386 14:103549774-103549796 CTGTGAAAGCACTGGGGATGCGG + Intergenic
1122728533 14:103777504-103777526 CTGTGGCGGCAGATGGGCTATGG - Intronic
1122792321 14:104189218-104189240 CTGGGACAGTACAGGGGGTGAGG + Intergenic
1122960207 14:105090715-105090737 ATCTGGGAGCCCAGGGGCTGGGG + Intergenic
1122968867 14:105144355-105144377 CTGAGGCCGCAGAGGGGGTGGGG - Intronic
1123207324 14:106726131-106726153 CTGTGGCATGGCAGGTGCTGAGG + Intergenic
1123414122 15:20082683-20082705 CTGGAGCAGCTCAGGGGCCGAGG + Intergenic
1123523464 15:21089794-21089816 CTGGAGCAGCTCAGGGGCCGAGG + Intergenic
1124032065 15:26020774-26020796 TTCTGGCAGCACAGAGTCTGGGG + Intergenic
1124367321 15:29081292-29081314 CTGTGGGACCAGAGGGGATGTGG + Intronic
1125485980 15:40111130-40111152 CTGGGACAGCACAGGCCCTGAGG + Intergenic
1125723078 15:41854387-41854409 CTGCGGCAGGCCAGGGGGTGGGG + Intronic
1125724727 15:41862453-41862475 CTAGGGGAACACAGGGGCTGAGG + Intronic
1126108330 15:45161571-45161593 CCCAGGCAGCACTGGGGCTGAGG - Intronic
1126181647 15:45791376-45791398 CTGTGCCAGCACAGTGTGTGAGG + Intergenic
1126846421 15:52764913-52764935 TTGGAGCAGCAAAGGGGCTGAGG - Intronic
1127997573 15:64162665-64162687 CTGGGTCAGGGCAGGGGCTGGGG + Intronic
1128114634 15:65097511-65097533 CAATGGCAGCACTGGGGTTGAGG - Intronic
1128115638 15:65103130-65103152 TGGTGGCAGCAAAGGGGCTGGGG - Intronic
1128148290 15:65344858-65344880 CTTAGACAGCACAGGGACTGGGG + Intronic
1128224026 15:65989316-65989338 CTGGGGTAGCTCAGGGGCAGTGG - Intronic
1128646299 15:69381079-69381101 GTGTGGCAGCCCTGGGCCTGCGG + Intronic
1129056568 15:72824456-72824478 ATGGGGCAGGGCAGGGGCTGGGG + Intergenic
1129169115 15:73797154-73797176 CTGTGCGACCACAGGGTCTGTGG + Intergenic
1129786907 15:78315738-78315760 CTGTGGGAGAACAGGGGCTGAGG + Intergenic
1131092333 15:89632220-89632242 CTGTTCCAGTACAGGGGCTTGGG - Intronic
1131222406 15:90595963-90595985 GGGAGGCAGCTCAGGGGCTGTGG + Intronic
1132142540 15:99407467-99407489 CTTGGGCAACACAAGGGCTGAGG + Intergenic
1132762729 16:1518799-1518821 CTGTGGCAGAGCAGGGTGTGTGG + Intronic
1132803399 16:1764942-1764964 CGGTGGCAGCACAGGGCCATGGG - Intronic
1132873611 16:2126195-2126217 CTGTGGGAGTACAGGGGCTCCGG - Intronic
1133036393 16:3036362-3036384 CTAGGGCGGCTCAGGGGCTGGGG + Intronic
1133140815 16:3742742-3742764 GTGTGTCAGCACAGGCGTTGTGG - Intronic
1133264550 16:4575481-4575503 CTGTGCCAGGACTGGAGCTGGGG + Exonic
1133772741 16:8877113-8877135 GTGGGGCAGCACAGGGGCCCAGG - Intergenic
1133812243 16:9169800-9169822 CTGCACCAGCCCAGGGGCTGAGG - Intergenic
1134552698 16:15145369-15145391 CTGTGGGAGTACAGGGGCTCCGG - Intergenic
1135285826 16:21192108-21192130 CGTGGGCAGCACAGGGGTTGCGG - Intergenic
1135621530 16:23960057-23960079 CTGTGGAAGCACAGGAGGAGAGG + Intronic
1135830054 16:25765137-25765159 CTCTGGAAGCCCAGTGGCTGTGG - Intronic
1136284512 16:29233254-29233276 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1136455487 16:30377725-30377747 CCGGAGCAGCAAAGGGGCTGGGG + Intronic
1137351742 16:47719255-47719277 CTGTGGCTGCACATGGGAGGAGG - Intergenic
1137507170 16:49064253-49064275 CTGTGTAAGCACAGAGGCAGAGG - Intergenic
1138201844 16:55094518-55094540 CTGGGGCACTACAGGGGCTTGGG - Intergenic
1138381788 16:56607782-56607804 CTCAGGAAGCTCAGGGGCTGGGG - Intergenic
1138382351 16:56611354-56611376 CTCAGGAAGCTCAGGGGCTGGGG - Intergenic
1140507784 16:75484931-75484953 CTGTGTCTGCCCAGGGGGTGTGG - Intronic
1141635236 16:85310886-85310908 GTGTGTCTGCTCAGGGGCTGGGG + Intergenic
1141996433 16:87639067-87639089 CTGAGGCTGGAGAGGGGCTGTGG - Intronic
1142089547 16:88202767-88202789 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1142693277 17:1619862-1619884 CAGTGACTGCACAGGGGCCGTGG + Intronic
1143482563 17:7236096-7236118 TGTTGGCAGCACAGGGACTGGGG + Exonic
1143565795 17:7719820-7719842 CTGTGGCCACACAGGAGCAGGGG + Exonic
1144496619 17:15749856-15749878 CTGAGGCGGCTGAGGGGCTGAGG + Intergenic
1144496650 17:15749957-15749979 CTGAGGCGGCTGAGGGGCTGAGG + Intergenic
1144496658 17:15749982-15750004 CTGAGGCGGCTGAGGGGCTGAGG + Intergenic
1144496666 17:15750007-15750029 CTGAGGCGGCTGAGGGGCTGAGG + Intergenic
1144496677 17:15750040-15750062 CTGAGGCGGCTGAGGGGCTGAGG + Intergenic
1144496685 17:15750065-15750087 CTGAGGCGGCTGAGGGGCTGAGG + Intergenic
1144606206 17:16667263-16667285 CTGAGGCGGCTGAGGGGCTGAGG + Intergenic
1144606216 17:16667297-16667319 CTGAGGCGGCTGAGGGGCTGAGG + Intergenic
1144606231 17:16667357-16667379 CTGAGGCGGCTGAGGGGCTGAGG + Intergenic
1144669973 17:17127339-17127361 CAGTGGCAGCAGAGTGGCTCGGG - Intronic
1144686001 17:17226854-17226876 CTGTGGCTGCAGCGGGGCAGCGG - Intronic
1144827088 17:18111548-18111570 CTGTGCCTGCACAGAGGATGGGG + Intronic
1144904947 17:18634800-18634822 CTGAGGCGGCTGAGGGGCTGAGG - Intergenic
1144904960 17:18634842-18634864 CTGAGGCGGCTGAGGGGCTGAGG - Intergenic
1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG + Intronic
1146659979 17:34659158-34659180 CTCTGGAAACAGAGGGGCTGGGG - Intergenic
1146843289 17:36169006-36169028 CTGTAGGAGCAGGGGGGCTGGGG - Intronic
1147038855 17:37701804-37701826 ATGTGGCAGCATAGGGCTTGTGG + Intronic
1148603002 17:48908382-48908404 CTGTGGAAGCGGAGGGGGTGGGG + Exonic
1148623264 17:49050465-49050487 TTATGGGAGCACATGGGCTGGGG - Exonic
1148783235 17:50133230-50133252 CTGGCCCAGCACAGGGGCTGGGG + Intergenic
1149039045 17:52165581-52165603 CTGTGGCAGAACAGAGGTGGGGG + Intergenic
1149709643 17:58728762-58728784 CTGGTGAAGGACAGGGGCTGGGG - Intronic
1150213667 17:63455267-63455289 CACTGGGAGCTCAGGGGCTGGGG - Intergenic
1150284876 17:63949016-63949038 GTGGGGCAGCACTGGGGCTGGGG - Intronic
1150290671 17:63979673-63979695 ATGTGGCAGCTGAGGGTCTGGGG + Intergenic
1152115262 17:78382556-78382578 CTGTGGCAGAACTGGAGCTCAGG + Intronic
1152302474 17:79503322-79503344 CTGTGCCAGCTCCGGGGCAGAGG - Intronic
1154092877 18:11381312-11381334 CTGTAGGGACACAGGGGCTGGGG + Intergenic
1154316120 18:13304504-13304526 CTGTCGCAGCACAGGCTGTGGGG + Intronic
1155130531 18:22930280-22930302 AGGTGGCAGCACTGGGCCTGAGG + Intronic
1157616213 18:48989154-48989176 CTGGGGCTGCCCGGGGGCTGTGG + Intergenic
1158888501 18:61851414-61851436 CTGGGGCAGCTCAGGCGCTTGGG - Intronic
1160445059 18:78921391-78921413 CTGTGGCTGCTGGGGGGCTGTGG - Intergenic
1160503972 18:79417130-79417152 CTGTGGCGGGAGATGGGCTGTGG + Intronic
1160503977 18:79417147-79417169 CTGTGGCGGGAGATGGGCTGTGG + Intronic
1160503982 18:79417164-79417186 CTGTGGCGGGAGATGGGCTGTGG + Intronic
1160730676 19:640417-640439 CTGAGGCTCCAGAGGGGCTGGGG + Intronic
1161026907 19:2041123-2041145 CTTTGGCAGCGCAGGAGATGTGG + Exonic
1161273794 19:3404508-3404530 CAGAGGCTGCAGAGGGGCTGGGG + Intronic
1161335989 19:3713519-3713541 CTGGGGCGGCAAAGGGCCTGCGG + Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1161563490 19:4986570-4986592 CTGTGCCAGGCCAGGTGCTGAGG + Intronic
1161634208 19:5377119-5377141 CTGAGGCAGGACAGTGCCTGGGG + Intergenic
1162053701 19:8050533-8050555 CAGTGGCAGCCCACGGGCCGGGG - Intronic
1162534746 19:11256229-11256251 CCGTGGGCACACAGGGGCTGGGG + Intronic
1162545354 19:11325784-11325806 CTGTGGCAGGCCAGGCGCAGGGG + Intronic
1162933543 19:13969036-13969058 CTGAGGAGGCACAGGGGCTGTGG + Intronic
1163192391 19:15686800-15686822 CTGAGCCAGGGCAGGGGCTGGGG + Intronic
1163200880 19:15768245-15768267 CTGAGCCAGGCCAGGGGCTGGGG - Intergenic
1163441185 19:17323530-17323552 CTGGGCCAGCACACGGCCTGGGG + Exonic
1163529966 19:17843261-17843283 CTGTGGCAGTCCAGGGGTGGGGG - Intronic
1163558828 19:18007316-18007338 CTGTGGCGGGACGGGGGCTGAGG + Intronic
1163622748 19:18370483-18370505 CTGTGGTAACACAGGCACTGGGG + Intergenic
1163916513 19:20245147-20245169 CTGTGGAGGCACAGGTGCTGTGG - Intergenic
1164526179 19:29015211-29015233 AGGTGGCAGCAAAGAGGCTGGGG - Intergenic
1165241860 19:34475540-34475562 GTGTGGCAGCACACAGGGTGTGG - Intergenic
1165403001 19:35613680-35613702 CTGGGGCAGCACACAGGGTGTGG - Intronic
1165825550 19:38703756-38703778 TTGGGGCAGCACAGGGGCCAGGG + Intronic
1166326005 19:42051536-42051558 CAGAGGCAGCCTAGGGGCTGCGG - Intronic
1167036020 19:46995451-46995473 CTCTGACAGGACAGGGGATGGGG - Intronic
1167079789 19:47271123-47271145 CTGTGGAGTCTCAGGGGCTGGGG - Exonic
1167468442 19:49662502-49662524 CTGGGGCTCCGCAGGGGCTGAGG + Exonic
1167638079 19:50666826-50666848 TGGTGGCAGCGCAGGGGGTGGGG - Exonic
1167647123 19:50711877-50711899 CTGAGGCATCCAAGGGGCTGGGG - Intronic
1168107625 19:54174131-54174153 CCCTGGCAGCCCTGGGGCTGGGG - Exonic
1168254645 19:55158727-55158749 CTGTGGCTGACTAGGGGCTGGGG - Exonic
1168343573 19:55640061-55640083 CTGTGGCACCCCAGGGTCTTGGG + Intronic
1168659568 19:58155241-58155263 CAGTGGCAGCAGGGAGGCTGTGG + Intergenic
925156374 2:1651577-1651599 CTGTGGCTGGAAAGGGGGTGAGG - Intronic
925258783 2:2511926-2511948 CTCTGAGAGCAGAGGGGCTGTGG + Intergenic
927193779 2:20534197-20534219 CTCTGGCACCCCAGGGGCTCAGG - Intergenic
927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG + Intergenic
927853004 2:26511499-26511521 CTGTGCCAGAACAGGGTGTGAGG - Intronic
927942641 2:27114803-27114825 CTGGGGCAGCTCAGAGGCTGGGG - Intronic
928088301 2:28359170-28359192 CTCAGACAGCCCAGGGGCTGGGG - Intergenic
928318783 2:30266858-30266880 TTGGGTCAGCACAGGGCCTGGGG - Intronic
928373558 2:30758079-30758101 CTGTGGAACCCCTGGGGCTGGGG - Exonic
929121780 2:38489589-38489611 CTGAGGCTGCAGAGGGACTGGGG - Intergenic
929291157 2:40193465-40193487 CTGTGTGAGCACAGTGGGTGGGG + Intronic
929997300 2:46836650-46836672 CGGTGTCAGCACTTGGGCTGGGG + Intronic
930054305 2:47240203-47240225 CTGTGGAATGAGAGGGGCTGGGG + Intergenic
931226449 2:60335988-60336010 CTGAGGCAGCTCAGGGACTGCGG + Intergenic
931288676 2:60853809-60853831 GTGTGGCATCACAGAGGCAGAGG - Intergenic
932300080 2:70660644-70660666 ATGTGGAAGCTCAGGGGTTGAGG - Exonic
932668800 2:73719218-73719240 CCCAGGCAGCTCAGGGGCTGAGG + Intergenic
933026443 2:77265455-77265477 AGATGGCAGCACAGGGGCAGCGG - Intronic
935312796 2:101802186-101802208 GGGTGGCAGCACAGAGGCTGTGG - Intronic
935594296 2:104867551-104867573 CTGTGGGAGCGCAGGGGCAGAGG - Intergenic
936059556 2:109285544-109285566 CGGTGGGAGCCCAGAGGCTGAGG + Intronic
936398388 2:112147639-112147661 CTGCGGCTACACAGGGGCTTTGG + Intronic
936493429 2:112995969-112995991 CTATGGCCCCACAGGGTCTGGGG + Intergenic
936542239 2:113361783-113361805 CCGTGGAGGCACAGGGCCTGGGG + Intergenic
937226845 2:120375166-120375188 CTGTGGCTGCCGAGGAGCTGAGG + Intergenic
937238909 2:120447668-120447690 CTTTGACAGCTCAGGGGCTCAGG - Intergenic
937285507 2:120748424-120748446 CTTTGCCAGCAGAGGGGTTGGGG + Intronic
937613485 2:123892651-123892673 CTGTTGCAGCACAGTCCCTGTGG - Intergenic
938142970 2:128811765-128811787 CTCTGGCAGCCCAAGGACTGAGG - Intergenic
938406862 2:131037590-131037612 CTGGGGCTGCACAGGAGGTGAGG - Intronic
938616731 2:133007087-133007109 CTTAGGGAGCACAGGGCCTGAGG - Intronic
941055003 2:160777269-160777291 CTGAGGCACTGCAGGGGCTGAGG - Intergenic
941842604 2:170103041-170103063 CTGTGGCCTGTCAGGGGCTGGGG - Intergenic
942219858 2:173758348-173758370 CTGTGTTAGCAGAGGGTCTGAGG + Intergenic
942544221 2:177045695-177045717 CTGTGACAGCTCAGGGATTGTGG + Intergenic
942919767 2:181358183-181358205 CTGTGGCTGCCAGGGGGCTGAGG - Intergenic
944473517 2:200080861-200080883 TTGAGGCAGCAAAGGGGCTGTGG - Intergenic
945297114 2:208181732-208181754 CAGTGGCAGCGCAGGGGAGGTGG - Intronic
946253120 2:218425569-218425591 CTGTGGGAGCCCAGGGTCTCGGG + Intronic
946410846 2:219514518-219514540 CAGAGGCAGCACCAGGGCTGCGG + Exonic
947929600 2:233952703-233952725 CTCTGGCAGCAGTGGGGCAGAGG + Intronic
948495462 2:238345856-238345878 CTGTGGAAGCACAGGCGTCGGGG + Intronic
948628325 2:239284364-239284386 CTGGGTCAGCACAGTGGCTCAGG - Intronic
948699550 2:239751365-239751387 CCGGGGTGGCACAGGGGCTGCGG + Intergenic
948731032 2:239963828-239963850 CTGAGGCTGCAGAGGGACTGAGG + Intronic
948939643 2:241189467-241189489 CTGTGGGAGGACAGGTGCCGTGG - Intronic
949045155 2:241869527-241869549 CTGTGGCAGCACCGTGGTGGTGG - Intergenic
1168773858 20:432730-432752 CAGGGGCAGGACAGGGGCAGGGG + Intergenic
1168837962 20:890369-890391 CTGTGGGAGACCATGGGCTGGGG + Intronic
1169044445 20:2524735-2524757 CTGTTGCAGCGCCGGGGCTGGGG - Intergenic
1170612984 20:17929363-17929385 CTTTGGCAGCACAGGGAGTGAGG + Intergenic
1170705830 20:18744201-18744223 CAGTGCCAGCAGCGGGGCTGAGG + Exonic
1170924742 20:20712588-20712610 CGGCGGCAGCAGCGGGGCTGGGG - Intergenic
1170959671 20:21014057-21014079 CTGCGGCAGCTCAGAGGCTGGGG - Intergenic
1172754195 20:37272030-37272052 CTGTGGGAGCAGAGTGGGTGTGG + Intergenic
1172990873 20:39035644-39035666 TGGTGGCATCACAGGGGCTTAGG + Intronic
1173136313 20:40442341-40442363 CTGGGGGAGCACAGAGGCAGAGG + Intergenic
1173253351 20:41376032-41376054 TCGGGGCAGCAGAGGGGCTGTGG - Intergenic
1173834382 20:46115698-46115720 CTGTGGCAACACAGGGGAGGAGG + Intergenic
1173863141 20:46297309-46297331 CTGTGGGAGAACAGGGGCTCTGG + Intronic
1174129195 20:48329780-48329802 CTGGGGAAGCACAGGAGGTGGGG + Intergenic
1174467532 20:50729843-50729865 CTGTGGCAGCACAGGTGGAAAGG - Intergenic
1174572551 20:51512398-51512420 CTGAGGGAGCTCAGGGGCTGCGG - Intronic
1174683283 20:52429077-52429099 ATGTGGCAGCACAGCATCTGAGG - Intergenic
1174881301 20:54282118-54282140 CTATGGCAGCAAAGCAGCTGGGG + Intergenic
1175142947 20:56874078-56874100 CGGTCGCAGCCCAGGGGTTGGGG + Intergenic
1175944548 20:62552599-62552621 CAGTGGCAGGACAGGGGCCAGGG + Intronic
1175982454 20:62745930-62745952 CTGTGGCATCAGTGGCGCTGAGG + Intronic
1176275020 20:64260501-64260523 CTGTGGCAGCACAGGAAGAGGGG - Intronic
1176297204 21:5080443-5080465 CTGAGGCAGGGCAGGGGCAGGGG + Intergenic
1176381642 21:6116817-6116839 CGGTTTCGGCACAGGGGCTGTGG - Intronic
1178756390 21:35354140-35354162 CCGTGGATGCCCAGGGGCTGAGG - Intronic
1178758182 21:35373287-35373309 CTGTGAGAGCACAGGGGGTGGGG - Intronic
1178803976 21:35823441-35823463 ATGTGGCAGCACAGGTGAAGAGG - Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179141544 21:38730215-38730237 CTGTGGGTGGCCAGGGGCTGGGG - Intergenic
1179316802 21:40251036-40251058 ATGCTGCAGCACAAGGGCTGTGG - Intronic
1179584306 21:42365231-42365253 CTGTGGGATCACAGAGGCCGTGG - Intronic
1179741830 21:43421422-43421444 CGGTTTCGGCACAGGGGCTGTGG + Intronic
1179818454 21:43922753-43922775 GTCTCCCAGCACAGGGGCTGTGG + Intronic
1179859825 21:44181505-44181527 CTGAGGCAGGGCAGGGGCAGGGG - Intergenic
1182269530 22:29144832-29144854 CTGTGACAGCACATTGGCTTGGG - Intronic
1182352992 22:29709326-29709348 CAGGGGCAGGACATGGGCTGTGG - Intergenic
1182545995 22:31076885-31076907 CTGGAGCAGCTCAGGGGCTGAGG - Intronic
1182711053 22:32323611-32323633 CAGAGGGAGCCCAGGGGCTGAGG + Intergenic
1183057852 22:35318047-35318069 CTATGGCAGCAATGGGGCTGGGG - Intronic
1183063664 22:35349833-35349855 CTGGGGCTGCATGGGGGCTGGGG + Intergenic
1183149898 22:36028919-36028941 CTGTGGCAGCACCGGGAAGGCGG + Intergenic
1183187958 22:36303252-36303274 CTGCTGCAGGACAGCGGCTGTGG - Intronic
1183405798 22:37630017-37630039 CTGGGCCAGAGCAGGGGCTGGGG - Exonic
1183424695 22:37733226-37733248 AGGTGGGAGCAGAGGGGCTGGGG + Intronic
1183538344 22:38415898-38415920 CCGTGGCTGCTGAGGGGCTGAGG + Intergenic
1183711426 22:39506002-39506024 CTTTGGCAGTACAGGGCCAGGGG + Intronic
1184398585 22:44260485-44260507 CAGAGGGAGCCCAGGGGCTGAGG + Intronic
1184676380 22:46045411-46045433 CAGGGGCAGCACAGGAGGTGAGG + Intergenic
1184773726 22:46612920-46612942 CTGTGGGTGAGCAGGGGCTGTGG - Intronic
1184787369 22:46678396-46678418 CTGGGGCAGGGCGGGGGCTGGGG - Exonic
1184856868 22:47151054-47151076 CTGTGGCCCCTCAGAGGCTGAGG + Intronic
1185060593 22:48604506-48604528 CTGTAGCACCACAGGGGCCTGGG - Intronic
1185221214 22:49630092-49630114 CTGTGGACGCACAGGGGCCGCGG - Intronic
1185401815 22:50622872-50622894 CTGGGGCAGCCCTGGGGGTGAGG - Intronic
949376140 3:3392510-3392532 CAGTGCCAGCACTGGGGATGGGG - Intergenic
950161474 3:10764216-10764238 GTGTGGCAGTGGAGGGGCTGTGG + Intergenic
950701765 3:14755497-14755519 CTGGGGCAGAGCAGGGGGTGGGG - Intronic
950727081 3:14923531-14923553 GCGTGGCAGCAGAGGAGCTGGGG + Intronic
951287947 3:20838104-20838126 CTTTGGAAGCACAGATGCTGGGG + Intergenic
953822672 3:46221948-46221970 CAGTGGCAAGAGAGGGGCTGGGG - Intronic
954214385 3:49116316-49116338 CTGAGGCTGCACCCGGGCTGTGG - Exonic
954378871 3:50209100-50209122 CTGTGGCCCCCCAGGGGCAGGGG - Intronic
954629695 3:52041122-52041144 GTGTTCCTGCACAGGGGCTGAGG - Intergenic
954676079 3:52316114-52316136 TGGTGACATCACAGGGGCTGTGG - Intergenic
954851717 3:53606561-53606583 CAGTGGCAGGCCAAGGGCTGTGG + Intronic
957040606 3:75332858-75332880 CTGTGGCAGCTCCTGGGATGGGG - Intergenic
958993430 3:100873868-100873890 CTGTGGCCAAACAGGGGCTTGGG + Intronic
959977139 3:112473549-112473571 CTGTGGCAGGAAAGTGGGTGTGG - Intronic
961045393 3:123704419-123704441 CTGTGGCAGCTCCTGGGATGGGG - Intronic
961171593 3:124801404-124801426 AGGTGGCAGGGCAGGGGCTGAGG - Intronic
961282395 3:125774314-125774336 CTGTGGAAGGATAGGGGCTTTGG - Intergenic
961371020 3:126431614-126431636 CTGTGGAAGGACAAGAGCTGAGG + Intronic
961667513 3:128502903-128502925 GTGTGGGAGCACAGGGGTGGGGG + Intergenic
962655689 3:137542238-137542260 CTGTGGCAGCACAGGGTGCAGGG + Intergenic
962932168 3:140048791-140048813 CTGTGGCAGCTGGAGGGCTGTGG - Intronic
962967036 3:140364975-140364997 CTGGGGGAGCCCAGGTGCTGAGG + Intronic
963224259 3:142845684-142845706 CTGTGACAGGCCAGGGGCGGTGG + Intronic
963515359 3:146301556-146301578 CTGGGGTAGCACAGTGGCTATGG + Intergenic
964391392 3:156201565-156201587 CAGTGTCAGCGCAGGGGCGGGGG + Intronic
964526142 3:157616792-157616814 CTGAGGGGGCCCAGGGGCTGAGG - Intronic
964595057 3:158416614-158416636 CTGGGGCAACACAAAGGCTGAGG - Intronic
966013095 3:175106082-175106104 GTGTGAATGCACAGGGGCTGAGG - Intronic
967866498 3:194194345-194194367 CTGGGGGAGCACGGGGGCAGTGG - Intergenic
968134538 3:196211443-196211465 GTGTGACATCACAGAGGCTGGGG + Intergenic
968703742 4:2068857-2068879 CTTGGGGAGCACAGGGGGTGGGG + Exonic
968716804 4:2166256-2166278 CTCAGGCTGCTCAGGGGCTGAGG - Intronic
968772290 4:2515039-2515061 CCCTGACAGCACAGGGCCTGGGG + Exonic
968832114 4:2937870-2937892 CTGTTCCAGCAGAGGGACTGTGG + Intergenic
968945252 4:3660220-3660242 CTGTGACAGACCAGGGGCTGGGG + Intergenic
970581436 4:17477543-17477565 CAGTGGCATCTCAGGGGCAGTGG - Intronic
972920477 4:43934399-43934421 CTGTTGCAGGCCAGGTGCTGTGG + Intergenic
975766575 4:77674884-77674906 CTGTGGCAGGCCAGGTGCAGTGG + Intergenic
975886573 4:78973424-78973446 ATGTGTCAGTAAAGGGGCTGTGG + Intergenic
975947841 4:79729305-79729327 AAGTGGCAGCACAGGGGTGGAGG + Intergenic
976384025 4:84434453-84434475 CTGAGGCCTGACAGGGGCTGGGG - Intergenic
978205521 4:106076143-106076165 CAGTGGCAGCTCAGGTGCTGTGG + Intronic
978710186 4:111770681-111770703 CTGTGGCAGCACAGGGCTGGGGG + Intergenic
980762088 4:137248012-137248034 CTGTGGAGGCAGAAGGGCTGTGG - Intergenic
984764104 4:183386330-183386352 CTGAGGCAGCACAGGGCCAGAGG - Intergenic
985627725 5:998546-998568 CTTTGGCTGCACTGGTGCTGGGG + Intergenic
985719616 5:1482383-1482405 CTGAGGCAGGACATGGGCAGGGG + Intronic
986203378 5:5599861-5599883 CCCTGACAGCAAAGGGGCTGTGG - Intergenic
987228751 5:15870454-15870476 CTGTGGCAGTAGAGAGGATGAGG + Intronic
988218507 5:28310825-28310847 CAGTGGCTGCAGATGGGCTGAGG - Intergenic
989216337 5:38908094-38908116 CAGTGGCAGCACAGGGGTAGGGG - Intronic
992120555 5:73587761-73587783 CTCTAGCAGCTCAGGGTCTGAGG + Intergenic
992183689 5:74222849-74222871 CTGTGGCAGCAAAGAGGAAGTGG + Intergenic
992888845 5:81185467-81185489 CACTGGCAGCCCAGGGCCTGGGG + Intronic
994613764 5:102078172-102078194 GTGGGGAAGCACAGGGGGTGAGG - Intergenic
995676576 5:114669254-114669276 CTGAGGCAGCACAGTGTTTGGGG - Intergenic
997226567 5:132213730-132213752 AGGTGGCAGGGCAGGGGCTGAGG + Intronic
997350757 5:133229937-133229959 CTTTGGGAGCACAGGGACAGTGG + Intronic
997581719 5:135021532-135021554 CAGTGGGAGGACAGGGGCAGTGG + Intergenic
997757685 5:136415071-136415093 CCTGGGCAGCACAGGGGCTGAGG + Intergenic
998387511 5:141766253-141766275 ATGGGGCAGCACAGGGGTGGGGG - Intergenic
1001640210 5:173238666-173238688 CTGTATCAACAAAGGGGCTGCGG + Intergenic
1002176504 5:177404091-177404113 CTGTGGAGGAGCAGGGGCTGAGG + Intronic
1002304474 5:178275080-178275102 CTGAGGCAGCACCAGGGCTGGGG - Intronic
1002406486 5:179037647-179037669 CTGTGCCATCAGAGCGGCTGGGG + Intergenic
1002465356 5:179405652-179405674 CTGTGGCAGGGCAGGGACAGGGG + Intergenic
1003130718 6:3393132-3393154 CTGTGGCAGCCTGGAGGCTGTGG + Intronic
1003384194 6:5652296-5652318 CTGTGGCAGGATAGGGGATGGGG + Intronic
1003634959 6:7823749-7823771 CTGTGGCAGGAGACTGGCTGGGG + Intronic
1004643104 6:17534649-17534671 CTGTGGGAGAACAGGCTCTGTGG - Intronic
1005187571 6:23180438-23180460 CTGTGGCAGACAAGGAGCTGTGG + Intergenic
1005427852 6:25722704-25722726 ATGTGACAGCAAAGGGGCTTGGG + Intergenic
1005809908 6:29507492-29507514 CTGTGGCAGCCATGGGGCTTAGG - Intergenic
1006306682 6:33225634-33225656 TGGTGGCTGCACAGGGGCTAGGG + Intergenic
1006601132 6:35226984-35227006 TGTTGGCAGCACAGGGGCCGAGG + Intronic
1006603620 6:35241840-35241862 CTGGAGCAGCCCTGGGGCTGGGG - Exonic
1006651729 6:35557282-35557304 CTGTGCCAGCCGAAGGGCTGGGG - Intergenic
1006817674 6:36863911-36863933 CTGTGAAAGCAGAGGGGCGGAGG - Intronic
1007753475 6:44083889-44083911 GAGAGGCAGCAGAGGGGCTGGGG + Intergenic
1010009728 6:71036299-71036321 CTGTGCCAGCACAGGGGTCTGGG - Intergenic
1011022318 6:82828297-82828319 CTGGGGCCTCACAGGGGGTGGGG + Intergenic
1011482358 6:87807899-87807921 CTGTGGCAGACCAGAGGATGAGG - Intergenic
1012043336 6:94238566-94238588 CTGTGGGAGCACAAGGGGTTGGG + Intergenic
1013205624 6:107942632-107942654 TTGTGACTGCACAGGGGGTGGGG - Intronic
1013706901 6:112846814-112846836 CTCTGGCAGCTCAAAGGCTGGGG + Intergenic
1014513168 6:122349649-122349671 CAGTGGCAGCTCAGGGGGTGTGG + Intergenic
1014705652 6:124743075-124743097 CTGTGGCATCACAGAGGCAGGGG + Intronic
1017194053 6:151681508-151681530 CTCTGGAAGCACAGGGACTGTGG + Intronic
1017721364 6:157245618-157245640 CTGTGGAAGCAACGGTGCTGCGG + Intergenic
1018021760 6:159767731-159767753 CTGATGCAGCTCAGGGGCTGAGG + Intronic
1018503993 6:164444029-164444051 CTGTAGTAGCCCAGGTGCTGTGG - Intergenic
1018685007 6:166297649-166297671 CTGTGTCATCCCAGGGTCTGCGG - Intergenic
1018928345 6:168222587-168222609 CTGTGGCTGCCCAGTGGCAGGGG - Intergenic
1019032276 6:169023998-169024020 CTGCGGCCGCCCTGGGGCTGCGG - Intergenic
1019053327 6:169201307-169201329 CTGTGGCAGCACAGGGATTCTGG - Intergenic
1019199050 6:170298984-170299006 CTGACTCATCACAGGGGCTGAGG + Intronic
1019456388 7:1129987-1130009 CTGTGGCACCACACGGGCTGCGG + Intronic
1019554796 7:1623908-1623930 CTCTGGGAGCACAGAGTCTGGGG - Intergenic
1019710080 7:2514153-2514175 CTGAGCCCGCACAGGGCCTGGGG - Intronic
1019746887 7:2705772-2705794 CTGTAGGACCTCAGGGGCTGGGG - Intronic
1019921187 7:4164202-4164224 CTGTGGCTTCCCAGGGGCAGAGG - Intronic
1020347626 7:7182648-7182670 CAGCGGCAGCACAGCGGCGGCGG - Exonic
1021662542 7:22934726-22934748 CTGTGGAATCACACAGGCTGTGG + Intergenic
1021825283 7:24544774-24544796 CAGCCGCAGCAGAGGGGCTGAGG + Intergenic
1022818267 7:33934095-33934117 ATGAGGCAGCCCAGGGGGTGAGG + Intronic
1023120527 7:36903988-36904010 CTGAGGCAGCCCAGGGGGAGTGG - Intronic
1023326801 7:39069514-39069536 CTTGAGCAGCACAGGGGTTGGGG + Intronic
1024226934 7:47332522-47332544 CTGGGGCAGCTCGCGGGCTGGGG - Intronic
1024262015 7:47580510-47580532 GTGTGGTAGCACAGGGGGTGGGG - Intronic
1024559197 7:50629302-50629324 CTGTGGAACAACAGGGGTTGGGG - Intronic
1024610368 7:51059086-51059108 CCGTGGCAGCACAGGGGGCAAGG - Intronic
1026894181 7:74000510-74000532 CTCTGGCAGCAGAGAGACTGGGG + Intergenic
1027542814 7:79489488-79489510 TTGTGGGAGCACAGTGGCAGGGG + Intergenic
1028371206 7:90094396-90094418 TTGTGGAAGGACAGTGGCTGGGG - Intergenic
1028792874 7:94873415-94873437 CTGTGGCTGCTCTGGGGATGAGG + Intergenic
1029074006 7:97921742-97921764 CTGTGGAAGGATAGGGGCTTTGG + Intergenic
1029364128 7:100106530-100106552 ATGTGGGAGGAGAGGGGCTGGGG - Intronic
1029551178 7:101237878-101237900 CCGGGGCAGCCCAGAGGCTGGGG - Intronic
1029591845 7:101512166-101512188 CTGAGTCAGCACAGGGGAGGAGG + Intronic
1032420513 7:131775537-131775559 CTGTGACAGAACAGGGACTAGGG + Intergenic
1033357868 7:140615321-140615343 CTGAGGCAGCACAGAGCCTTTGG - Intronic
1033391120 7:140928402-140928424 CTATGGCAGCACTGGGGGTTTGG - Intergenic
1034255892 7:149724539-149724561 CCGTGGAGGCACAGGGGCTTTGG + Intronic
1034522497 7:151631930-151631952 CTGCGGAAGCCCAGGGGCCGGGG - Intronic
1034540366 7:151754505-151754527 CTGGGCCAGCACTGGGGCTTAGG + Intronic
1034959935 7:155358841-155358863 CGAGGGCAGCGCAGGGGCTGGGG - Intronic
1034987248 7:155523910-155523932 CTGTGGCACTACAGAGGCAGAGG + Intronic
1036228085 8:6976876-6976898 CTGAGGCAGCCCAGGGGCCCAGG - Intergenic
1036230538 8:6995993-6996015 CTGAGGCAGCCCAGGGGCCCAGG - Intergenic
1036232987 8:7015096-7015118 CTGAGGCAGCCCAGGGGCCCAGG - Intronic
1036656106 8:10678514-10678536 CTGGGGCAGTGCAGGGGCTGAGG - Intronic
1036729529 8:11250094-11250116 CTGAGGCCGCACAGTGGTTGAGG - Intergenic
1037753680 8:21698216-21698238 TGGAGGCAGCACAGGGACTGTGG + Intronic
1039454947 8:37699921-37699943 ATGCGGCAGCGCGGGGGCTGCGG + Exonic
1039620505 8:38992865-38992887 CTGTGTCAGCACAGTGGATAAGG - Intronic
1039798337 8:40933879-40933901 GTGGGGCAGCACACGGGCAGTGG - Intergenic
1041682422 8:60606816-60606838 CTGAGGCAACACAGGTGGTGGGG + Intronic
1042551099 8:69994764-69994786 CTGTAGCAGCTGAAGGGCTGCGG - Intergenic
1043441534 8:80280853-80280875 GTGTGGCACCCCAGGGGCTGTGG + Intergenic
1043647311 8:82536641-82536663 GTGAGGAAGCACAGGGGCTCGGG - Intergenic
1045500094 8:102738393-102738415 CTGTGGGAGCACCAGGGCTGTGG + Intergenic
1047480340 8:125276176-125276198 CCTGGGCAGTACAGGGGCTGGGG - Intronic
1047751260 8:127882366-127882388 CTGTGGTACCCCAGGAGCTGGGG - Intergenic
1048026271 8:130590052-130590074 CTGTAGAAGCACAGGCTCTGAGG - Intergenic
1048699644 8:137074534-137074556 CTGGGGCATATCAGGGGCTGGGG - Intergenic
1048993961 8:139777839-139777861 TTGTGACAGCACAGGGAGTGGGG + Intronic
1049059178 8:140263001-140263023 CAGCTGCAGCACAAGGGCTGTGG + Intronic
1049256438 8:141616569-141616591 CTGCGGCAGCTCAGGTGCTCTGG + Intergenic
1049268762 8:141683273-141683295 CGGCCACAGCACAGGGGCTGGGG + Intergenic
1049283148 8:141760747-141760769 CTGCGGCAGCCCAGGGGCCGGGG - Intergenic
1049328262 8:142035272-142035294 GAGTTGGAGCACAGGGGCTGGGG - Intergenic
1049478607 8:142808330-142808352 CAGAGGCAGGACAGGGGCTGGGG + Intergenic
1049531497 8:143157826-143157848 CTGAGGGAGCGGAGGGGCTGGGG - Intergenic
1049558172 8:143294007-143294029 CTGTGGCAGCAGAGGAGAAGCGG - Intronic
1049562079 8:143316966-143316988 CTGGGGCAGCACTGGGGCTGTGG - Intronic
1049573472 8:143380128-143380150 CTGCGGCAGCACAGGGCCTCGGG - Exonic
1049761365 8:144333206-144333228 CTGTGGCGGCGCAGGAGCCGCGG + Exonic
1052339413 9:27350873-27350895 CCATGGCAGCAGAGGGGCAGAGG - Intronic
1052866283 9:33466426-33466448 CTGTGGAAGAAGAGGGGCTGAGG + Intronic
1053269342 9:36739637-36739659 CGGTGGCCGCACAAAGGCTGGGG + Intergenic
1053570814 9:39304351-39304373 CCCTGGCTGCACAGGTGCTGTGG - Intergenic
1053836756 9:42145267-42145289 CCCTGGCTGCACAGGTGCTGTGG - Intergenic
1054092434 9:60863370-60863392 CCCTGGCTGCACAGGTGCTGTGG - Intergenic
1054113849 9:61138963-61138985 CCCTGGCTGCACAGGTGCTGTGG - Intergenic
1054126331 9:61314661-61314683 CCCTGGCTGCACAGGTGCTGTGG + Intergenic
1054593850 9:67043225-67043247 CCCTGGCTGCACAGGTGCTGTGG + Intergenic
1056334112 9:85549247-85549269 CTGTGCCAGCACAGGGTCTGGGG + Intronic
1057010360 9:91595988-91596010 CTGTTGGAGGACAGGGGGTGGGG - Intronic
1057182629 9:93038127-93038149 ATGGGGCAGCACAGAGTCTGGGG + Intergenic
1057357348 9:94342704-94342726 CTGTGCCAGCACAGGGCATGGGG - Intergenic
1057650404 9:96914922-96914944 CTGTGCCAGCACAGGGCATGGGG + Intronic
1059735891 9:117099301-117099323 CTATGGCATCCAAGGGGCTGTGG - Intronic
1060020027 9:120121332-120121354 ATGTGGTAGCACAGTGGATGAGG - Intergenic
1060528667 9:124334772-124334794 CTGTGGGAGGACCCGGGCTGAGG + Intronic
1060657352 9:125381059-125381081 CTGTCACAGCAGAGGGTCTGTGG + Intergenic
1060666217 9:125433570-125433592 CTGGGGCAGCAGAGGGGCTCAGG + Intergenic
1060829761 9:126706117-126706139 AGGTGGCAGCTCAGGGGATGGGG - Intergenic
1060938570 9:127530188-127530210 CTGTGGCAGCAGAGCGTCAGAGG - Intronic
1061240190 9:129365672-129365694 CTGTGGCAGGCCAGGTGCGGTGG + Intergenic
1061277238 9:129576618-129576640 CTGTTGCCGCACAGTGGCTTTGG + Intergenic
1061425082 9:130493609-130493631 CTGGGTCAGCCCAGGGGCTGCGG - Intronic
1061635030 9:131902320-131902342 CTGCGGCAGCAAGGGGGATGAGG + Intronic
1062171719 9:135138483-135138505 TTGATGCAGCACAGGAGCTGGGG - Intergenic
1062403082 9:136380927-136380949 CTGGGGCAGCCCTGAGGCTGGGG + Intronic
1062428864 9:136518112-136518134 AGGTGCCAGCACAGGGGGTGCGG - Intronic
1062464752 9:136676017-136676039 CAGAGGCAGGACAGGTGCTGGGG + Intronic
1062466944 9:136685755-136685777 CTGAAGCACCCCAGGGGCTGAGG + Intronic
1062730102 9:138103916-138103938 CAGGGGCAGGGCAGGGGCTGAGG - Intronic
1186907888 X:14131341-14131363 TTTTGGAAGCACAGGGGCTGGGG + Intergenic
1187004009 X:15213855-15213877 CTGGGACAGCACTGCGGCTGGGG + Intergenic
1187366354 X:18668805-18668827 CCGTGGTTGCCCAGGGGCTGGGG + Intronic
1187479947 X:19646163-19646185 CAGTGGAAGCATAGGGTCTGAGG - Intronic
1187953617 X:24494211-24494233 CTCTGGAAGCACAGGGTCTCTGG + Intronic
1188009816 X:25043672-25043694 CAGGGGCAGCCAAGGGGCTGGGG + Intergenic
1190265619 X:48826102-48826124 TTGAGGCAGCACAGGCTCTGTGG + Intergenic
1191033942 X:56005516-56005538 TATTGGCAGCACAGGGGGTGGGG + Intergenic
1191251159 X:58260843-58260865 CAGGCCCAGCACAGGGGCTGTGG - Intergenic
1192158904 X:68768320-68768342 CAGTGACAGAACAGGAGCTGGGG - Intergenic
1192497858 X:71628183-71628205 CTGAGATAGCGCAGGGGCTGGGG + Intergenic
1192656939 X:73002820-73002842 CTGTGGCTGCTGCGGGGCTGCGG - Intergenic
1192665181 X:73080181-73080203 CTGTGGCTGCTGCGGGGCTGCGG + Intergenic
1198522201 X:137464483-137464505 CAGTGGCCCCTCAGGGGCTGGGG + Intergenic
1199591393 X:149471151-149471173 CTGTGGCTGCCCAGGGGCCTGGG + Intergenic
1199640780 X:149858891-149858913 CTGTGGCGGCACGGGGGAGGGGG - Intergenic
1199666177 X:150098241-150098263 CTGAGCCAGCACAGGGCATGGGG + Intergenic
1201283446 Y:12360139-12360161 GTGTGGAAGCACTGGGGCTCGGG + Intergenic