ID: 1145829781

View in Genome Browser
Species Human (GRCh38)
Location 17:27906719-27906741
Sequence CTTCTGTGCACCTCTGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145829777_1145829781 5 Left 1145829777 17:27906691-27906713 CCATTTCTTCACTGCAGAAGCAG No data
Right 1145829781 17:27906719-27906741 CTTCTGTGCACCTCTGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145829781 Original CRISPR CTTCTGTGCACCTCTGCATG GGG Intergenic
No off target data available for this crispr