ID: 1145832431

View in Genome Browser
Species Human (GRCh38)
Location 17:27927527-27927549
Sequence CAAGCTAGTCCCTTGTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145832431_1145832435 25 Left 1145832431 17:27927527-27927549 CCTTGCCACAAGGGACTAGCTTG No data
Right 1145832435 17:27927575-27927597 TGATAATATATCAATCAGTGCGG No data
1145832431_1145832433 0 Left 1145832431 17:27927527-27927549 CCTTGCCACAAGGGACTAGCTTG No data
Right 1145832433 17:27927550-27927572 AGACTAAGCTATTTTCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145832431 Original CRISPR CAAGCTAGTCCCTTGTGGCA AGG (reversed) Intergenic
No off target data available for this crispr