ID: 1145834210

View in Genome Browser
Species Human (GRCh38)
Location 17:27941692-27941714
Sequence CACTACCAGACCAAAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145834210_1145834218 19 Left 1145834210 17:27941692-27941714 CCCTTTGTTTTGGTCTGGTAGTG No data
Right 1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG No data
1145834210_1145834216 12 Left 1145834210 17:27941692-27941714 CCCTTTGTTTTGGTCTGGTAGTG No data
Right 1145834216 17:27941727-27941749 ATCGATCCAGTAGCAAAGGATGG No data
1145834210_1145834219 29 Left 1145834210 17:27941692-27941714 CCCTTTGTTTTGGTCTGGTAGTG No data
Right 1145834219 17:27941744-27941766 GGATGGAAGTTGGAAGTTTGTGG No data
1145834210_1145834214 8 Left 1145834210 17:27941692-27941714 CCCTTTGTTTTGGTCTGGTAGTG No data
Right 1145834214 17:27941723-27941745 GCCAATCGATCCAGTAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145834210 Original CRISPR CACTACCAGACCAAAACAAA GGG (reversed) Intergenic
No off target data available for this crispr