ID: 1145834213

View in Genome Browser
Species Human (GRCh38)
Location 17:27941719-27941741
Sequence TGCTACTGGATCGATTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145834213_1145834218 -8 Left 1145834213 17:27941719-27941741 CCTGGCCAATCGATCCAGTAGCA No data
Right 1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG No data
1145834213_1145834219 2 Left 1145834213 17:27941719-27941741 CCTGGCCAATCGATCCAGTAGCA No data
Right 1145834219 17:27941744-27941766 GGATGGAAGTTGGAAGTTTGTGG No data
1145834213_1145834222 20 Left 1145834213 17:27941719-27941741 CCTGGCCAATCGATCCAGTAGCA No data
Right 1145834222 17:27941762-27941784 TGTGGCGAGAAAGGACAGGAAGG No data
1145834213_1145834221 16 Left 1145834213 17:27941719-27941741 CCTGGCCAATCGATCCAGTAGCA No data
Right 1145834221 17:27941758-27941780 AGTTTGTGGCGAGAAAGGACAGG No data
1145834213_1145834220 11 Left 1145834213 17:27941719-27941741 CCTGGCCAATCGATCCAGTAGCA No data
Right 1145834220 17:27941753-27941775 TTGGAAGTTTGTGGCGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145834213 Original CRISPR TGCTACTGGATCGATTGGCC AGG (reversed) Intergenic
No off target data available for this crispr