ID: 1145834218

View in Genome Browser
Species Human (GRCh38)
Location 17:27941734-27941756
Sequence CAGTAGCAAAGGATGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145834208_1145834218 23 Left 1145834208 17:27941688-27941710 CCCACCCTTTGTTTTGGTCTGGT No data
Right 1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG No data
1145834210_1145834218 19 Left 1145834210 17:27941692-27941714 CCCTTTGTTTTGGTCTGGTAGTG No data
Right 1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG No data
1145834206_1145834218 24 Left 1145834206 17:27941687-27941709 CCCCACCCTTTGTTTTGGTCTGG No data
Right 1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG No data
1145834213_1145834218 -8 Left 1145834213 17:27941719-27941741 CCTGGCCAATCGATCCAGTAGCA No data
Right 1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG No data
1145834211_1145834218 18 Left 1145834211 17:27941693-27941715 CCTTTGTTTTGGTCTGGTAGTGA No data
Right 1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG No data
1145834209_1145834218 22 Left 1145834209 17:27941689-27941711 CCACCCTTTGTTTTGGTCTGGTA No data
Right 1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145834218 Original CRISPR CAGTAGCAAAGGATGGAAGT TGG Intergenic
No off target data available for this crispr