ID: 1145835569

View in Genome Browser
Species Human (GRCh38)
Location 17:27952125-27952147
Sequence GCGTGGGATGAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145835562_1145835569 21 Left 1145835562 17:27952081-27952103 CCTTGGGTACAGAAATAAAATGC No data
Right 1145835569 17:27952125-27952147 GCGTGGGATGAGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145835569 Original CRISPR GCGTGGGATGAGAGGGAAGC AGG Intergenic
No off target data available for this crispr