ID: 1145836925

View in Genome Browser
Species Human (GRCh38)
Location 17:27961363-27961385
Sequence CTCTGGAAGGCTAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145836919_1145836925 -8 Left 1145836919 17:27961348-27961370 CCTGTAATCCCAGCACTCTGGAA 0: 316
1: 17802
2: 310705
3: 259932
4: 145685
Right 1145836925 17:27961363-27961385 CTCTGGAAGGCTAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145836925 Original CRISPR CTCTGGAAGGCTAAGGTGGA AGG Intergenic
No off target data available for this crispr