ID: 1145841892

View in Genome Browser
Species Human (GRCh38)
Location 17:28002037-28002059
Sequence GATGGAGGAGCTGACCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145841884_1145841892 17 Left 1145841884 17:28001997-28002019 CCTGACAGAGGGAAAGAATGCAG No data
Right 1145841892 17:28002037-28002059 GATGGAGGAGCTGACCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145841892 Original CRISPR GATGGAGGAGCTGACCCAGG AGG Intergenic
No off target data available for this crispr