ID: 1145846209

View in Genome Browser
Species Human (GRCh38)
Location 17:28041554-28041576
Sequence TCCCGCCCCCGATCCGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145846209_1145846217 11 Left 1145846209 17:28041554-28041576 CCCATCCCGGATCGGGGGCGGGA No data
Right 1145846217 17:28041588-28041610 GACCCACACCTTGTTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145846209 Original CRISPR TCCCGCCCCCGATCCGGGAT GGG (reversed) Intergenic
No off target data available for this crispr