ID: 1145846211

View in Genome Browser
Species Human (GRCh38)
Location 17:28041559-28041581
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145846211_1145846217 6 Left 1145846211 17:28041559-28041581 CCCGGATCGGGGGCGGGATTTCC No data
Right 1145846217 17:28041588-28041610 GACCCACACCTTGTTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145846211 Original CRISPR GGAAATCCCGCCCCCGATCC GGG (reversed) Intergenic
No off target data available for this crispr