ID: 1145846496

View in Genome Browser
Species Human (GRCh38)
Location 17:28042607-28042629
Sequence ACTTGTGGCAGGAATCCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145846486_1145846496 7 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1145846486 17:28042577-28042599 CCCCAAATTAAGAATGGAGTTTT 0: 1
1: 0
2: 4
3: 30
4: 346
Right 1145846496 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 178
1145846485_1145846496 8 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1145846485 17:28042576-28042598 CCCCCAAATTAAGAATGGAGTTT 0: 1
1: 1
2: 0
3: 19
4: 257
Right 1145846496 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 178
1145846488_1145846496 5 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1145846488 17:28042579-28042601 CCAAATTAAGAATGGAGTTTTAG 0: 1
1: 1
2: 2
3: 15
4: 211
Right 1145846496 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 178
1145846482_1145846496 29 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1145846482 17:28042555-28042577 CCACATTCAAAGTTGGAACCTCC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1145846496 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 178
1145846481_1145846496 30 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1145846481 17:28042554-28042576 CCCACATTCAAAGTTGGAACCTC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1145846496 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 178
1145846484_1145846496 11 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1145846484 17:28042573-28042595 CCTCCCCCAAATTAAGAATGGAG 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1145846496 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 178
1145846487_1145846496 6 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1145846487 17:28042578-28042600 CCCAAATTAAGAATGGAGTTTTA 0: 1
1: 0
2: 2
3: 45
4: 387
Right 1145846496 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145846496 Original CRISPR ACTTGTGGCAGGAATCCTGG GGG Exonic
901417457 1:9127823-9127845 ACTGAGGGCAGGAATCCTAGGGG - Intronic
904679797 1:32221449-32221471 ACTTGGGGAAGGCTTCCTGGAGG - Intronic
904902125 1:33865621-33865643 ACCTGTGTAAGGAGTCCTGGGGG + Intronic
906638580 1:47427149-47427171 CCATTTGGCAGGAAGCCTGGAGG - Intergenic
907441914 1:54484166-54484188 ACTTCTGGTAGGCAGCCTGGAGG + Intergenic
909404544 1:75272912-75272934 AGTTCTGTGAGGAATCCTGGTGG + Intronic
911041873 1:93597807-93597829 ACTTGTGGCAGGCAGCCTCCAGG - Intronic
912587705 1:110781522-110781544 ACTTGTGGGAGGACTTCTGCAGG + Intergenic
913203813 1:116517385-116517407 AGCTGTGGCAGGAGGCCTGGGGG - Intronic
913491325 1:119382820-119382842 ACTTGTATCAGGAATCAGGGGGG + Intronic
915216518 1:154344111-154344133 TCTTGTGCCAGGAATCCTTGTGG + Intronic
921408801 1:214812456-214812478 ACTTGTGGATGGAAAGCTGGAGG + Intergenic
922544309 1:226444315-226444337 AGATGAGGCAGGAATCCAGGAGG + Intergenic
922583856 1:226719334-226719356 ACTTTGGTAAGGAATCCTGGTGG + Intronic
924427313 1:243964278-243964300 AGTTGTTGCAGGAATCCTAGTGG + Intergenic
1063158111 10:3398277-3398299 ACTTGTAACAGGAGTGCTGGTGG + Intergenic
1063167332 10:3475451-3475473 AGTTGAGGCAGGAATCCAAGAGG + Intergenic
1063470412 10:6280168-6280190 ACGTGAGGCAGTTATCCTGGAGG - Intergenic
1064267842 10:13839437-13839459 TTTTATGGCAGGAATCCTGTTGG - Intronic
1064791102 10:18958846-18958868 ACTTGTGGCCAGAATGCTGAGGG + Intergenic
1065781277 10:29170326-29170348 CCAAGAGGCAGGAATCCTGGAGG + Intergenic
1067361506 10:45584613-45584635 ACCAGGGGCAGGAATCTTGGAGG - Intronic
1069223915 10:65917496-65917518 ACATCTGGCAGGGATACTGGTGG + Exonic
1074099378 10:110342390-110342412 GCTTGTGGTAGGGAGCCTGGGGG - Intergenic
1078550890 11:12279943-12279965 CCTTGTGGAAGGAACCCTGCTGG + Intronic
1081538603 11:44014075-44014097 ACTGCTGGCAGCACTCCTGGGGG - Intergenic
1083519157 11:63291590-63291612 ACTTCTGACTGGAATGCTGGTGG + Exonic
1085190236 11:74614317-74614339 AAATGTGGCAGTAATCCAGGTGG + Intronic
1085477850 11:76799049-76799071 GCTTGTGGAAGGAGTCCTTGCGG + Intergenic
1091784089 12:3231790-3231812 AGAGGTGGGAGGAATCCTGGAGG - Intronic
1092040311 12:5378389-5378411 ACTGGGGCCAAGAATCCTGGTGG - Intergenic
1092059722 12:5538484-5538506 AACTGTGATAGGAATCCTGGGGG + Intronic
1092609253 12:10154242-10154264 TCTTGTGGCTGGAATCCTAGAGG + Intergenic
1095923146 12:47551278-47551300 AATTATGGCAGTTATCCTGGTGG + Intergenic
1096634197 12:52948383-52948405 ACTTGTGGAGGGGATCTTGGGGG - Intronic
1097229143 12:57498516-57498538 ACTTGTCGCAGATCTCCTGGGGG - Exonic
1100120785 12:91366999-91367021 ACCTGTGACAGGAATTCAGGTGG - Intergenic
1101598542 12:106188736-106188758 ACTGGTGGCAGAAATCCCAGCGG - Intergenic
1101683313 12:106990203-106990225 ACTTGAGGCATGAACCCAGGAGG - Intergenic
1102509193 12:113402816-113402838 CCTTGGGGCAGGGATCCTTGGGG - Intronic
1103601861 12:122059602-122059624 ACCTCTGGCATGTATCCTGGTGG + Exonic
1106043353 13:26115041-26115063 ACCTGGGGGAGGAAGCCTGGTGG + Intergenic
1106904020 13:34386137-34386159 ACTGCTGTCAGGAATCCTGCAGG - Intergenic
1110228766 13:73146884-73146906 ACTGGTGGCTGAATTCCTGGTGG + Intergenic
1113024052 13:105921084-105921106 AAGTGAGGCAAGAATCCTGGAGG + Intergenic
1113142917 13:107174799-107174821 AGTTGTGCATGGAATCCTGGTGG + Intronic
1113795238 13:113053427-113053449 CTTTGGGGCGGGAATCCTGGTGG + Intronic
1114656668 14:24319873-24319895 ACTGGTGGTAGAGATCCTGGGGG + Exonic
1115882839 14:37939518-37939540 AGTTGTGGAAGGAATACTGCAGG + Intronic
1116188982 14:41638186-41638208 ACTAATGGCAGAAATCCTGGAGG - Intronic
1119776776 14:77253931-77253953 ATTTGTGGCAGGGATGCGGGTGG - Intronic
1122635669 14:103128548-103128570 ACTTTAGGAAGGAAGCCTGGAGG + Intronic
1125309782 15:38366166-38366188 AGTTTTGGCAAGAATCCTGCTGG - Intergenic
1127950154 15:63797441-63797463 TCTTGAGGCAGGAGTCCAGGTGG - Intronic
1128995558 15:72291873-72291895 ACTTGTGGCTGGAATTCTGATGG + Intronic
1129055718 15:72818677-72818699 ACTTGCAGCAGGGCTCCTGGTGG - Intergenic
1129272084 15:74424309-74424331 ATTTGTTTCAAGAATCCTGGTGG - Intronic
1129304591 15:74650144-74650166 TCTTGTGGTAGGATTCCAGGTGG - Intronic
1130703867 15:86213252-86213274 ACTACTGGGAGGCATCCTGGAGG + Intronic
1131400077 15:92117675-92117697 ACCTGTGGCAGGAGACCTGTCGG - Intronic
1132387700 15:101411951-101411973 AGTTGTGTCAGGATGCCTGGTGG + Intronic
1133326964 16:4947728-4947750 ACTTGTGGGAGGTATTGTGGGGG - Intronic
1137553251 16:49454711-49454733 ACTTGGAGCATGAATCCAGGAGG - Intergenic
1139637702 16:68268205-68268227 ATTTGTGCCAGGTATCCTGTTGG + Intronic
1140329719 16:74042388-74042410 ACTTGTGGGAGGAATCCTTGTGG - Intergenic
1141246477 16:82312476-82312498 ATTTGTGGCAGAATTGCTGGAGG + Intergenic
1143162025 17:4878176-4878198 GCACGTGGCAGGAACCCTGGTGG - Intronic
1144662550 17:17080584-17080606 ACCTGGGGCAGGAATGCTGCTGG + Intronic
1145846496 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG + Exonic
1152161513 17:78671273-78671295 ACTGGGGGCTAGAATCCTGGGGG + Intergenic
1152353204 17:79794772-79794794 CCCTGTGGCCAGAATCCTGGGGG - Exonic
1153823051 18:8848865-8848887 AGGGGTGGCAGGATTCCTGGGGG - Intergenic
1153914479 18:9733631-9733653 ACCTGTGGACCGAATCCTGGAGG - Intronic
1157200349 18:45654120-45654142 TCTTTTGGCAGGAATGCTGGGGG + Intronic
1161748118 19:6074230-6074252 GCTTGTGGCAGGAGTTCAGGTGG + Intronic
1162158651 19:8696508-8696530 ACTTGTGGGGGGCATCCTAGGGG + Intergenic
1164147303 19:22519835-22519857 ACAGGTGGCAGGAAACCTGCTGG + Intronic
1164159297 19:22616275-22616297 ACAGGTGGCAGGAAACCTGCTGG - Intergenic
1166586623 19:43954637-43954659 ACTTGTGTCAGAATTCCTGAGGG - Intronic
927514717 2:23665456-23665478 ACTTTTGGCAGGGGTACTGGTGG - Intronic
928423586 2:31159482-31159504 ACTTGTGTCAAGAACCCTTGTGG + Intergenic
932433709 2:71690734-71690756 ACTTGTGGGAGGCATCCTTGAGG + Intergenic
934034037 2:88073996-88074018 ACTTGTGGAAAGAATCAGGGAGG + Intronic
935499184 2:103817844-103817866 ACTTTTTGCAGGATTCTTGGTGG + Intergenic
937350986 2:121161567-121161589 ATTTGTGGCAGAAATTTTGGGGG - Intergenic
937711438 2:124984672-124984694 ACTTGTTGCATGAACCCGGGAGG - Intergenic
937934582 2:127232560-127232582 TCTTGGAGCAGGAGTCCTGGTGG + Intergenic
938251462 2:129818995-129819017 GCATGTGCCAGGAATTCTGGAGG - Intergenic
938387092 2:130874303-130874325 ACAGGTCCCAGGAATCCTGGTGG + Intronic
938702236 2:133889924-133889946 ACTTGTAGCAGGATTCCAAGAGG + Intergenic
938956181 2:136300647-136300669 AGTGGTTGCAGGAATCATGGAGG + Intergenic
939548884 2:143588741-143588763 ATTTGTGGGAGAATTCCTGGTGG - Intronic
942767686 2:179476055-179476077 ACATGTGGCAGGCATTTTGGGGG - Intronic
943036459 2:182751998-182752020 ACTTGTTGCAGAAATGATGGGGG + Intronic
944927623 2:204480960-204480982 TCTGGTGGGAGGAAGCCTGGTGG + Intergenic
946132460 2:217617614-217617636 TCCTGAGGCAGGAGTCCTGGGGG - Intronic
946448141 2:219757388-219757410 ACTTGTTTCTGCAATCCTGGGGG + Intergenic
947183164 2:227430826-227430848 ACTTTTGGCAGGAATACCAGAGG + Intergenic
947517769 2:230822325-230822347 GCTGGTGGCAGGATTCCTGGAGG - Intergenic
948568295 2:238900375-238900397 ACTGGGGGCAGGAGTCCAGGGGG - Intronic
1169110350 20:3028865-3028887 AGCTGTGGCAGTAATGCTGGTGG + Intronic
1169422773 20:5473210-5473232 GCATGTGGCAGGGGTCCTGGTGG + Intergenic
1169426651 20:5502265-5502287 ACATGTGGCAGGGGTCCTGGTGG - Intergenic
1171111371 20:22485608-22485630 TAATGTGGAAGGAATCCTGGGGG + Intergenic
1172733472 20:37108459-37108481 TTTTGTAGCAGGAATCCTGTTGG - Intronic
1172832561 20:37848534-37848556 ACTTGTGACAGGGGGCCTGGGGG + Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173564151 20:44027407-44027429 ACTCAAGGCAGGAAGCCTGGTGG - Intronic
1174323790 20:49762997-49763019 TCTTGTGATAGGAATCCTGCTGG + Intergenic
1174333586 20:49841329-49841351 AGTTGGGGCAGGCTTCCTGGAGG + Intronic
1176287191 21:5024315-5024337 ACGTGGGGAAGGCATCCTGGGGG + Intronic
1179413669 21:41181034-41181056 AATTCTGGCAGGAATCAGGGTGG - Intronic
1179869990 21:44239160-44239182 ACGTGGGGAAGGCATCCTGGGGG - Intronic
1180062179 21:45391056-45391078 ACTTGTGGGAGGAGGCCTGGGGG - Intergenic
1181520575 22:23447107-23447129 ACGTGGGGCAGGAGTCCCGGAGG - Intergenic
1183397861 22:37583177-37583199 CTTTGGGGCAGGAATCCAGGTGG - Intergenic
949947574 3:9202624-9202646 AGATGGGGCAGGAATCCAGGAGG - Intronic
954384413 3:50236792-50236814 ACAAGTGGCGGGCATCCTGGGGG - Intronic
954983863 3:54771817-54771839 ACTTGGGGCAGAAATCTTGGGGG + Intronic
955200132 3:56844570-56844592 CCTGTTGGCTGGAATCCTGGTGG - Intronic
956789500 3:72669580-72669602 TCTTGTGCCATGAATCCTGTTGG + Intergenic
957381907 3:79442500-79442522 ACTTATGGAAGGCATTCTGGTGG + Intronic
959228848 3:103620633-103620655 CCTCATGGGAGGAATCCTGGTGG - Intergenic
961667143 3:128499472-128499494 AATTCTGCCAGTAATCCTGGGGG - Intergenic
961814961 3:129544658-129544680 ACCTGAGGGAGGACTCCTGGGGG + Intronic
970340873 4:15105365-15105387 ACTAGGGCCAGGAATCTTGGAGG + Intergenic
970820097 4:20201906-20201928 ACTTGTGCAAGGACTCCAGGTGG - Intergenic
971230099 4:24794661-24794683 ATTTGTTGCAGGAATGCAGGAGG + Intronic
973343871 4:49033183-49033205 ATTTGTAGCAGTAATCCTGCAGG - Intronic
975909141 4:79247810-79247832 ACTGGTCTCAGGAATCTTGGCGG + Intronic
977426612 4:96874787-96874809 AGCTGTGTCAGGAAACCTGGGGG - Intergenic
977818310 4:101442090-101442112 ACTTGAGGAAGGAACTCTGGTGG + Intronic
977987654 4:103402969-103402991 GCTTGTCCCAGGATTCCTGGAGG + Intergenic
978153558 4:105464603-105464625 TGTTGTGGGAGGAATCCTGGTGG + Intronic
979521870 4:121676657-121676679 AACTGTGACAGGAAGCCTGGGGG + Intronic
981015810 4:139973258-139973280 ACTTGTTGGAGAAATCCTGCTGG - Intronic
981830189 4:148990589-148990611 ACTGGGGGAAGGAATCCAGGAGG - Intergenic
981903175 4:149890242-149890264 ACTTTTGGCAGGAATGTAGGAGG + Intergenic
982022368 4:151215579-151215601 ATTTAAGGCAGGAATCCTGAAGG - Intronic
982125065 4:152177357-152177379 ATCTGTGGCCGTAATCCTGGAGG + Intergenic
982914288 4:161185927-161185949 ACTTGTGGCATGAAGTGTGGTGG - Intergenic
983905033 4:173172981-173173003 ACAGGTAGCAGGAGTCCTGGTGG + Intronic
985352570 4:189081533-189081555 TGTTGTGGGAGGGATCCTGGAGG - Intergenic
988867870 5:35355070-35355092 ATTTGTGGCTGGAATCCTTCAGG + Intergenic
989771959 5:45155769-45155791 ACGTGTGGCAGTATTCCTTGTGG - Intergenic
997667996 5:135647791-135647813 ACCTGTGGCGGGAATCCCTGGGG + Intergenic
998875364 5:146593730-146593752 CCTAGAGGCAGGAATCCTGGAGG + Intronic
999143929 5:149380494-149380516 ACTTGTGGCCTGAATCTTGGAGG - Intronic
999471191 5:151856933-151856955 AGTTCTGGCAGGAAGCATGGTGG + Intronic
1000592433 5:163174618-163174640 AAATGTGGCAGCAATCGTGGAGG + Intergenic
1002418905 5:179135275-179135297 ACTGATGGCAGGAGTCGTGGAGG - Intronic
1002605094 5:180378251-180378273 CCTTGTGTCAGGAAACTTGGGGG - Intergenic
1006394461 6:33778035-33778057 ATTGGTGGCAGGAATCCGTGAGG - Intronic
1007278618 6:40693651-40693673 GCTTGTGGAAGGCTTCCTGGAGG - Intergenic
1009723122 6:67501769-67501791 GCTTGTGGCAGGACTCCTTTTGG + Intergenic
1012216901 6:96598155-96598177 AGTTGTGGCAGTACTCGTGGTGG - Intronic
1013070480 6:106724596-106724618 CCTAGAGGCAGGAATCATGGAGG - Intergenic
1014731100 6:125032118-125032140 ACTTGTGGGAGGGACCCAGGGGG - Intronic
1019184251 6:170211846-170211868 ACTTTTGGCAGGAAAACTCGAGG - Intergenic
1019590666 7:1829135-1829157 ACGTAGGGCAGGAGTCCTGGAGG + Intronic
1019913127 7:4113673-4113695 CCTTGGGGCAGGAAAGCTGGGGG + Intronic
1021412854 7:20347678-20347700 AGTTGTGGCAGGAATCTGAGTGG + Intronic
1022727348 7:32993003-32993025 TCTTGTGCCTGGAATCCTCGGGG + Intronic
1026471766 7:70699947-70699969 ACATGTGGCAGAGGTCCTGGGGG - Intronic
1027149103 7:75719918-75719940 ACTTGTGGCATGGACCCTAGGGG + Intronic
1028172739 7:87618165-87618187 AGTTGGGGCAGGACTCCAGGAGG - Intronic
1029130851 7:98329681-98329703 ACTTGAGACAGGAAGACTGGAGG - Intronic
1029170989 7:98628857-98628879 ACTTGGGGCAGGTGTCTTGGGGG - Exonic
1029666232 7:101996887-101996909 ACTGTGGGCAGGAATACTGGAGG - Intronic
1032177546 7:129644054-129644076 ACATGGGGCAGGCATCCTGAAGG - Intronic
1034561361 7:151881505-151881527 TGTTGTGGGAGGAATCATGGGGG - Intergenic
1034584022 7:152072850-152072872 GCTTGTGGCAGGATTGCTGACGG + Intronic
1034993203 7:155560982-155561004 GTGTGTGGCAGGAATCCTAGTGG - Intergenic
1036395103 8:8362709-8362731 TCTTGTGGCAGGATTGCTGATGG - Intronic
1036571354 8:9982395-9982417 GATTGTGGCAGGAAACTTGGTGG + Intergenic
1038436139 8:27537977-27537999 TCTTCTGCCAGGCATCCTGGTGG + Intronic
1040011417 8:42664157-42664179 CCTTGAGGCAGGGAACCTGGAGG - Intergenic
1040901143 8:52418432-52418454 ACTTATGGTGGGAATCCTAGGGG - Intronic
1042174893 8:66029105-66029127 ATGTGAAGCAGGAATCCTGGAGG - Intronic
1045203279 8:100009471-100009493 ATTTGTGGCAGGTTTGCTGGAGG - Intronic
1049307593 8:141913817-141913839 AGTTGTGGGGGAAATCCTGGAGG + Intergenic
1051400954 9:16681814-16681836 ACTTTGGGCAGGAATCCTTGCGG + Intronic
1056581095 9:87888450-87888472 AGTTGTGGGACAAATCCTGGTGG + Exonic
1057997630 9:99833695-99833717 CATTGTTGCAGGATTCCTGGTGG + Intronic
1186191759 X:7073615-7073637 ATTTGTGTCAGGAATACAGGAGG - Intronic
1186579741 X:10804972-10804994 CCTTGTGGGGGGAATCCTAGAGG + Intronic
1190005850 X:46737257-46737279 GTATTTGGCAGGAATCCTGGAGG + Intronic
1190942569 X:55056552-55056574 AATTGTGGGAGGGTTCCTGGTGG + Intergenic
1195154337 X:102108539-102108561 ACTTGTGGGAGGAACCCGGTGGG + Intergenic
1195654639 X:107323439-107323461 ACTTTTGCCAGGAGGCCTGGAGG + Intergenic
1195665676 X:107428053-107428075 ACATGAGTCAGGAATCTTGGGGG + Intergenic
1198481623 X:137046558-137046580 TCTGGTGGAAGGATTCCTGGTGG + Intergenic
1199302033 X:146223936-146223958 AGTTGTGGGAGGAATCCAGTAGG - Intergenic
1199597395 X:149516961-149516983 ACTTGTGGGAGGACTGTTGGAGG - Intronic
1202015411 Y:20401323-20401345 AGTTGTGGGAGAAATCCTGTGGG - Intergenic