ID: 1145864846

View in Genome Browser
Species Human (GRCh38)
Location 17:28234496-28234518
Sequence AAGCGCCTATTGAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145864846_1145864850 8 Left 1145864846 17:28234496-28234518 CCCCCAGAGTTCAATAGGCGCTT No data
Right 1145864850 17:28234527-28234549 ATAATGCTCCATGCACTTGAAGG 0: 7
1: 28
2: 40
3: 30
4: 112
1145864846_1145864851 9 Left 1145864846 17:28234496-28234518 CCCCCAGAGTTCAATAGGCGCTT No data
Right 1145864851 17:28234528-28234550 TAATGCTCCATGCACTTGAAGGG 0: 5
1: 31
2: 40
3: 34
4: 102
1145864846_1145864853 18 Left 1145864846 17:28234496-28234518 CCCCCAGAGTTCAATAGGCGCTT No data
Right 1145864853 17:28234537-28234559 ATGCACTTGAAGGGTTAAAAAGG 0: 13
1: 14
2: 29
3: 34
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145864846 Original CRISPR AAGCGCCTATTGAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr