ID: 1145869001

View in Genome Browser
Species Human (GRCh38)
Location 17:28258403-28258425
Sequence CCCTTGGCTCAGAGGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145869001_1145869013 27 Left 1145869001 17:28258403-28258425 CCCACATCCCTCTGAGCCAAGGG No data
Right 1145869013 17:28258453-28258475 CCTTAGCCAGGATGTCTGGCTGG No data
1145869001_1145869011 23 Left 1145869001 17:28258403-28258425 CCCACATCCCTCTGAGCCAAGGG No data
Right 1145869011 17:28258449-28258471 CCTGCCTTAGCCAGGATGTCTGG No data
1145869001_1145869008 15 Left 1145869001 17:28258403-28258425 CCCACATCCCTCTGAGCCAAGGG No data
Right 1145869008 17:28258441-28258463 TGAAGCCACCTGCCTTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145869001 Original CRISPR CCCTTGGCTCAGAGGGATGT GGG (reversed) Intergenic