ID: 1145869004

View in Genome Browser
Species Human (GRCh38)
Location 17:28258410-28258432
Sequence AGCTGTGCCCTTGGCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145869004_1145869013 20 Left 1145869004 17:28258410-28258432 CCCTCTGAGCCAAGGGCACAGCT No data
Right 1145869013 17:28258453-28258475 CCTTAGCCAGGATGTCTGGCTGG No data
1145869004_1145869011 16 Left 1145869004 17:28258410-28258432 CCCTCTGAGCCAAGGGCACAGCT No data
Right 1145869011 17:28258449-28258471 CCTGCCTTAGCCAGGATGTCTGG No data
1145869004_1145869008 8 Left 1145869004 17:28258410-28258432 CCCTCTGAGCCAAGGGCACAGCT No data
Right 1145869008 17:28258441-28258463 TGAAGCCACCTGCCTTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145869004 Original CRISPR AGCTGTGCCCTTGGCTCAGA GGG (reversed) Intergenic
No off target data available for this crispr