ID: 1145869008

View in Genome Browser
Species Human (GRCh38)
Location 17:28258441-28258463
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145869006_1145869008 -1 Left 1145869006 17:28258419-28258441 CCAAGGGCACAGCTCTCCTGTTT No data
Right 1145869008 17:28258441-28258463 TGAAGCCACCTGCCTTAGCCAGG No data
1145869005_1145869008 7 Left 1145869005 17:28258411-28258433 CCTCTGAGCCAAGGGCACAGCTC No data
Right 1145869008 17:28258441-28258463 TGAAGCCACCTGCCTTAGCCAGG No data
1145869004_1145869008 8 Left 1145869004 17:28258410-28258432 CCCTCTGAGCCAAGGGCACAGCT No data
Right 1145869008 17:28258441-28258463 TGAAGCCACCTGCCTTAGCCAGG No data
1145869003_1145869008 14 Left 1145869003 17:28258404-28258426 CCACATCCCTCTGAGCCAAGGGC No data
Right 1145869008 17:28258441-28258463 TGAAGCCACCTGCCTTAGCCAGG No data
1145869001_1145869008 15 Left 1145869001 17:28258403-28258425 CCCACATCCCTCTGAGCCAAGGG No data
Right 1145869008 17:28258441-28258463 TGAAGCCACCTGCCTTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145869008 Original CRISPR TGAAGCCACCTGCCTTAGCC AGG Intergenic