ID: 1145869013

View in Genome Browser
Species Human (GRCh38)
Location 17:28258453-28258475
Sequence CCTTAGCCAGGATGTCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145869004_1145869013 20 Left 1145869004 17:28258410-28258432 CCCTCTGAGCCAAGGGCACAGCT No data
Right 1145869013 17:28258453-28258475 CCTTAGCCAGGATGTCTGGCTGG No data
1145869006_1145869013 11 Left 1145869006 17:28258419-28258441 CCAAGGGCACAGCTCTCCTGTTT No data
Right 1145869013 17:28258453-28258475 CCTTAGCCAGGATGTCTGGCTGG No data
1145869003_1145869013 26 Left 1145869003 17:28258404-28258426 CCACATCCCTCTGAGCCAAGGGC No data
Right 1145869013 17:28258453-28258475 CCTTAGCCAGGATGTCTGGCTGG No data
1145869007_1145869013 -5 Left 1145869007 17:28258435-28258457 CCTGTTTGAAGCCACCTGCCTTA No data
Right 1145869013 17:28258453-28258475 CCTTAGCCAGGATGTCTGGCTGG No data
1145869005_1145869013 19 Left 1145869005 17:28258411-28258433 CCTCTGAGCCAAGGGCACAGCTC No data
Right 1145869013 17:28258453-28258475 CCTTAGCCAGGATGTCTGGCTGG No data
1145869001_1145869013 27 Left 1145869001 17:28258403-28258425 CCCACATCCCTCTGAGCCAAGGG No data
Right 1145869013 17:28258453-28258475 CCTTAGCCAGGATGTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145869013 Original CRISPR CCTTAGCCAGGATGTCTGGC TGG Intergenic
No off target data available for this crispr