ID: 1145874370

View in Genome Browser
Species Human (GRCh38)
Location 17:28305704-28305726
Sequence GTTCCATTAGAAACAGTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145874370_1145874372 12 Left 1145874370 17:28305704-28305726 CCCTTAACTGTTTCTAATGGAAC No data
Right 1145874372 17:28305739-28305761 TTTCCATATTCTACTTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145874370 Original CRISPR GTTCCATTAGAAACAGTTAA GGG (reversed) Intergenic
No off target data available for this crispr