ID: 1145879782

View in Genome Browser
Species Human (GRCh38)
Location 17:28344668-28344690
Sequence CACCCCATGCTGCTGCTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 3, 2: 7, 3: 68, 4: 443}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145879776_1145879782 -9 Left 1145879776 17:28344654-28344676 CCCGCCCCATTGGCCACCCCATG 0: 1
1: 0
2: 4
3: 30
4: 415
Right 1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG 0: 1
1: 3
2: 7
3: 68
4: 443
1145879771_1145879782 12 Left 1145879771 17:28344633-28344655 CCTATCTCCCATCCTGTGGAACC 0: 1
1: 0
2: 0
3: 21
4: 202
Right 1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG 0: 1
1: 3
2: 7
3: 68
4: 443
1145879773_1145879782 4 Left 1145879773 17:28344641-28344663 CCATCCTGTGGAACCCGCCCCAT 0: 1
1: 0
2: 1
3: 19
4: 139
Right 1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG 0: 1
1: 3
2: 7
3: 68
4: 443
1145879775_1145879782 0 Left 1145879775 17:28344645-28344667 CCTGTGGAACCCGCCCCATTGGC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG 0: 1
1: 3
2: 7
3: 68
4: 443
1145879777_1145879782 -10 Left 1145879777 17:28344655-28344677 CCGCCCCATTGGCCACCCCATGC 0: 1
1: 0
2: 3
3: 18
4: 246
Right 1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG 0: 1
1: 3
2: 7
3: 68
4: 443
1145879772_1145879782 5 Left 1145879772 17:28344640-28344662 CCCATCCTGTGGAACCCGCCCCA 0: 1
1: 0
2: 1
3: 11
4: 117
Right 1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG 0: 1
1: 3
2: 7
3: 68
4: 443
1145879770_1145879782 13 Left 1145879770 17:28344632-28344654 CCCTATCTCCCATCCTGTGGAAC 0: 1
1: 0
2: 1
3: 12
4: 174
Right 1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG 0: 1
1: 3
2: 7
3: 68
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145879782 Original CRISPR CACCCCATGCTGCTGCTGCC TGG Exonic
900152719 1:1185704-1185726 CATCCCTGGCTGCTGCTTCCGGG - Intronic
900292720 1:1930336-1930358 CCTCCCATGCTGCTGCTTGCAGG - Exonic
900365151 1:2308980-2309002 CACCCTTTCCTGCAGCTGCCAGG + Exonic
900653382 1:3742368-3742390 CACCCTGAGCTTCTGCTGCCAGG + Intergenic
901275313 1:7986675-7986697 CACTCCCTGCTCCTGCTGCCTGG - Intergenic
901648173 1:10727764-10727786 CAGCCCTGGCAGCTGCTGCCTGG - Intronic
901822667 1:11840234-11840256 CACCCTCTCCTGGTGCTGCCTGG + Exonic
902510821 1:16966081-16966103 CACCGCCTTCTGCAGCTGCCTGG - Exonic
903233381 1:21935263-21935285 CACCCCAGGCTGCTGGTGGTGGG - Intronic
903734580 1:25522166-25522188 CACCCAATGGTGATGCTGTCTGG + Intergenic
904296611 1:29523453-29523475 CCCCCCATTCTCCTGCTCCCAGG - Intergenic
904465487 1:30704931-30704953 CACCCAAGCCTGCTGCTCCCAGG + Intergenic
904810627 1:33161352-33161374 CCCCACATGCTGCTGCAGCCTGG - Intronic
904856264 1:33500248-33500270 CACCCCATGCTGCAGCTGAGTGG + Intergenic
905874775 1:41425966-41425988 CACCCCTTGGGACTGCTGCCAGG - Intergenic
906640665 1:47438847-47438869 CACCCGGAGCTGCTGCTGCGTGG + Exonic
906704112 1:47882235-47882257 CTCCCCATGCTGCCGTTGCATGG + Intronic
908363281 1:63390847-63390869 CATGCCATGCAGCTGCTGCTGGG + Intronic
908599113 1:65719685-65719707 TGCACCAGGCTGCTGCTGCCAGG + Intergenic
909270851 1:73621721-73621743 CATACCATGTAGCTGCTGCCAGG + Intergenic
909548191 1:76869344-76869366 CACCCCATGCAGCAGCTTCCCGG - Intronic
910349430 1:86278358-86278380 CATGCCATGCAGCAGCTGCCAGG + Intergenic
911690710 1:100830732-100830754 CACCCCTCCCTGCTGCTGACAGG + Intergenic
911723779 1:101220115-101220137 CACCCCATGCTCTGGCTGCCTGG + Intergenic
912459175 1:109819710-109819732 CAGCCGCTGCTGCTGCTACCAGG - Intergenic
912598419 1:110902920-110902942 CGCATCATGCTGCTGCTGCCAGG - Intergenic
912977346 1:114342570-114342592 CTGCCCATGCTGTGGCTGCCAGG - Intergenic
913115041 1:115689310-115689332 CACACCCTGCTGCTACTGCCAGG - Intronic
913129970 1:115830225-115830247 GGCTCCAGGCTGCTGCTGCCAGG + Intergenic
913416969 1:118619436-118619458 CTCCCTATGCTGCCACTGCCAGG + Intergenic
913550773 1:119915414-119915436 CACCCCACTCTGCTTCTGACTGG - Exonic
915315919 1:155029246-155029268 CTCCCCCTGCAGCTGGTGCCGGG + Exonic
915733298 1:158069036-158069058 CACCCCCTACTTCTGCCGCCTGG + Intronic
915834799 1:159168190-159168212 TTCCCCATGCTGCTCCTGCCCGG - Intergenic
917191242 1:172421802-172421824 CACACTATGTGGCTGCTGCCAGG - Intronic
917916520 1:179707898-179707920 TACCCCATGGTGCTGTTGCAAGG - Intergenic
918103719 1:181398607-181398629 CACACCCTGCTCCAGCTGCCAGG - Intergenic
918339158 1:183552972-183552994 GACCCCATGCTGTTGCTTCTTGG - Exonic
921042470 1:211447415-211447437 CGCACCATGCCACTGCTGCCAGG - Intergenic
921365995 1:214374443-214374465 CAGAGAATGCTGCTGCTGCCTGG + Intronic
922485819 1:225972449-225972471 CAGCCCATGCTGCTGTGCCCCGG + Intergenic
922568448 1:226617381-226617403 CAGCCCAGCCTGCTGCTTCCTGG - Intergenic
923921887 1:238575421-238575443 CACCCCATTGTGCTCCAGCCTGG - Intergenic
1063385170 10:5611954-5611976 AACCCCAGACTGCTGTTGCCAGG - Intergenic
1063427360 10:5960616-5960638 CACCCCGTGCTGCAGCTGAGAGG - Intronic
1063623060 10:7666876-7666898 CCCGCCATGCTCCTGCTGCTGGG - Exonic
1063908642 10:10806526-10806548 CACCCAGAGCTGCTGCTACCAGG - Intergenic
1063970801 10:11380046-11380068 CCCCCCAAGCTGCTCCTGCCAGG - Intergenic
1064072057 10:12238944-12238966 CACGCCATTGTGCTGCAGCCTGG + Intronic
1065925518 10:30431811-30431833 CGGCCCAGGCTGCTTCTGCCGGG + Intergenic
1066432667 10:35367656-35367678 CACACCTTCCTGCTGCTGCCTGG + Intronic
1067045061 10:42980812-42980834 CACCCCAACCTGCTCCTGGCTGG - Intergenic
1067069971 10:43124164-43124186 CAGCCCAGGCTGCCCCTGCCTGG - Intronic
1067733725 10:48832941-48832963 CACCCCTAGCTGCTGCTGAGTGG - Intronic
1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG + Intronic
1068741750 10:60481399-60481421 AATTCCATTCTGCTGCTGCCAGG - Intronic
1069519897 10:69110591-69110613 CACCCAATGCTCCTGCTCACTGG - Intergenic
1069578327 10:69546210-69546232 CACCCAGGGCTTCTGCTGCCAGG + Intergenic
1070312981 10:75287239-75287261 CCTCCCATGCTGCAGCTCCCTGG + Intergenic
1070551188 10:77491943-77491965 CATCCCAAGGGGCTGCTGCCTGG - Intronic
1071215379 10:83394438-83394460 CACGCCATGCTGCTGCTGTCAGG + Intergenic
1072564029 10:96602658-96602680 CACCTGATGCTGATGCTGACCGG - Intronic
1073134723 10:101214149-101214171 CACCCCATGTCTCTGCTGGCGGG - Intergenic
1073544111 10:104334770-104334792 CACCCCATGCTGCTCCTGCCTGG + Intronic
1074591961 10:114821993-114822015 CCGCCCCTGCTGCGGCTGCCGGG - Exonic
1075016229 10:118911822-118911844 CAGCACATGGTTCTGCTGCCAGG - Intergenic
1075547792 10:123368496-123368518 CACCCAGAGCTGCTGCAGCCTGG - Intergenic
1075715576 10:124553348-124553370 CACCCCCTGCACCTGCAGCCAGG + Intronic
1076061744 10:127418672-127418694 CGCCACTGGCTGCTGCTGCCTGG - Intronic
1076223193 10:128751400-128751422 CACCCCTTGCGGCTGTTGCTGGG - Intergenic
1076266106 10:129110985-129111007 CACTGCATGCTGCTGAGGCCAGG + Intergenic
1076719228 10:132385937-132385959 CACCCCATCCTGGAGATGCCAGG - Intergenic
1076867883 10:133177090-133177112 GGACCCATGCAGCTGCTGCCTGG + Intronic
1077192945 11:1263093-1263115 CACCACAGGCTTCTGCAGCCAGG - Intergenic
1077300418 11:1844118-1844140 CAGCCCCTGCTCCAGCTGCCTGG - Intergenic
1077392167 11:2305172-2305194 CACCTCCTGGAGCTGCTGCCGGG + Intronic
1077435893 11:2539056-2539078 CAGCCCATGGTGCTCCGGCCAGG + Intronic
1078242001 11:9538278-9538300 CACGCCATTATGCTGCAGCCTGG - Intergenic
1078843201 11:15097770-15097792 CACACCATGAGGCTGATGCCAGG + Intergenic
1079106726 11:17576790-17576812 CACCCCATGTTGCTGCACTCGGG - Intronic
1079182736 11:18208272-18208294 CAAACCATGCAGCTGCTGCTGGG - Intronic
1079801994 11:24880297-24880319 CACGCCATGAGGCTGCTGCCAGG + Intronic
1081493460 11:43583848-43583870 CACCCCAGGCTACTCCTTCCGGG + Intronic
1083065788 11:59922650-59922672 CACAGTATGCAGCTGCTGCCTGG - Intergenic
1083288429 11:61676015-61676037 CATCCCATCCTGCAGCTGCTGGG + Intergenic
1083535155 11:63460374-63460396 AACCCCATGCTGCTGCTTCTTGG - Intergenic
1083573025 11:63769755-63769777 GACCCCAGGCTGCTGCGCCCCGG - Intergenic
1083899200 11:65635560-65635582 CACCAGCTCCTGCTGCTGCCCGG - Exonic
1083921610 11:65784109-65784131 CTCCCGATGCTCCTTCTGCCTGG - Intergenic
1083925078 11:65801204-65801226 CACCCCATGCCCCAGCTGCTGGG + Intergenic
1084007249 11:66329947-66329969 CACCACAGGGAGCTGCTGCCTGG - Intergenic
1084729510 11:71064438-71064460 CATCCCAGCTTGCTGCTGCCTGG - Intronic
1084763970 11:71295449-71295471 CATGCCACGCGGCTGCTGCCAGG + Intergenic
1084785195 11:71438017-71438039 CACCCCCTGCTGCATCTGCGTGG - Intronic
1085300324 11:75454604-75454626 CATCCCTTGCTCCTGCTCCCTGG - Intronic
1085808309 11:79657272-79657294 AGCCCCATGCTGGAGCTGCCTGG + Intergenic
1086032983 11:82383169-82383191 CTCACCATGGAGCTGCTGCCAGG - Intergenic
1087007789 11:93486298-93486320 CACCCCAAGCAGCTGCTTCCAGG + Intronic
1087898146 11:103610437-103610459 CACCAGATGCTGATACTGCCAGG + Intergenic
1089158186 11:116417764-116417786 TGCCCCATGTTGGTGCTGCCTGG + Intergenic
1089271309 11:117303280-117303302 GACCCCAGGCTGCAGCTCCCTGG - Intronic
1089459278 11:118643335-118643357 CACCACATGCTAGTGCTGCAGGG + Intronic
1089569537 11:119395049-119395071 CACACCAAGCTGCTGCTGCTGGG + Intergenic
1089586616 11:119513580-119513602 AAGCCCCTGCTGCTGCTGGCAGG + Intergenic
1089681411 11:120120997-120121019 CCACCCAGGCTGCTGCTTCCCGG + Intronic
1089784548 11:120898661-120898683 CACCCCAGGATGCTGCAGCTGGG - Intronic
1090136492 11:124204472-124204494 CACCCCCAGCAGCTGCAGCCTGG - Intergenic
1090201883 11:124863430-124863452 CCCACCATGCGGCTCCTGCCCGG - Intergenic
1090398603 11:126434729-126434751 CACCCCAAGCTGAGGCTGCAGGG - Intronic
1090660221 11:128876855-128876877 CTCCCCAAGCAGCTGCTTCCTGG + Intergenic
1091208293 11:133835481-133835503 GAGCCCATGGTGCTGCTGCAGGG - Intergenic
1091688178 12:2578501-2578523 CACCCGCTGCTGCTGCAGCTTGG + Intronic
1092163249 12:6327676-6327698 CAACCCATGCTGACTCTGCCGGG + Exonic
1093537813 12:20243700-20243722 TACACCATGCTGCCGCTGCTGGG - Intergenic
1093990978 12:25590202-25590224 CTCACCACACTGCTGCTGCCAGG - Intronic
1094607596 12:31962172-31962194 CACCCCATCGTACTGCAGCCTGG + Intronic
1094658315 12:32441979-32442001 CACGCCATGCTGCTGCTCTCAGG + Intronic
1096154318 12:49333318-49333340 CAGCCCCTGCGGCGGCTGCCCGG - Intronic
1096692800 12:53331514-53331536 CCCACCATGCTGCTGCTACCAGG + Intronic
1097221882 12:57455895-57455917 CTCCCTCTGCTGCTCCTGCCAGG - Intronic
1097794797 12:63850067-63850089 CACCCTGTGAAGCTGCTGCCTGG - Intronic
1100523143 12:95395612-95395634 CATCCCATGCTGGTGCAACCTGG - Intergenic
1101716749 12:107318910-107318932 CACTTCATGCTGCAGCCGCCTGG - Exonic
1101786422 12:107887712-107887734 CAGCCTTTGCTGCTGCTGCTAGG - Intergenic
1101904548 12:108814902-108814924 CATCCCACTCCGCTGCTGCCTGG - Intronic
1103833877 12:123803399-123803421 CTCCCCATGGTGCTCCAGCCAGG + Intronic
1103938090 12:124487001-124487023 CACCCCATCCTACCCCTGCCAGG + Intronic
1103967937 12:124652127-124652149 CACCCCCCGCTGCAGCTGCCTGG + Intergenic
1106021124 13:25916418-25916440 CACCACATGCACCTGCTGCGGGG - Intronic
1106224376 13:27774030-27774052 GACCTCATGCTGCTGATGCCAGG + Intergenic
1106350103 13:28921880-28921902 CACACCATGCAGCCACTGCCAGG + Intronic
1107491367 13:40882839-40882861 CACATCCTGCTGCTGCTGGCTGG + Intergenic
1110703932 13:78582965-78582987 CACCACACCCTGCTGGTGCCAGG - Intergenic
1113589495 13:111488537-111488559 CACCTGCTGATGCTGCTGCCTGG - Intergenic
1113769895 13:112901064-112901086 CGCCCAGTTCTGCTGCTGCCTGG - Intronic
1114265649 14:21071171-21071193 CGCCCCAAGTTGCTGCTGCCAGG - Intronic
1116176206 14:41473490-41473512 CACACCATACTGCTGCTGTCAGG + Intergenic
1116313827 14:43360597-43360619 CAGAACCTGCTGCTGCTGCCTGG - Intergenic
1118225774 14:63897788-63897810 CTCCCCCTGCTCCTGCTCCCAGG + Intronic
1118241290 14:64060977-64060999 CCTGCCATGCTGCTGCTGCTGGG + Intronic
1119665337 14:76481271-76481293 CACCCACAGCTCCTGCTGCCTGG - Intronic
1119768159 14:77203808-77203830 CCCCACCTCCTGCTGCTGCCAGG - Intronic
1122205635 14:100146601-100146623 CAGCCCACACTGCTGTTGCCAGG + Exonic
1122634585 14:103123973-103123995 CCCCCCAGCCTCCTGCTGCCCGG - Intronic
1124232257 15:27955784-27955806 CTGTCCATGCTGCTCCTGCCGGG + Intronic
1124364553 15:29062823-29062845 GGCCCCAAGCTGCTGCAGCCGGG - Intronic
1125044621 15:35231358-35231380 TGCACCATGCTGCTGCTTCCGGG + Intronic
1125507592 15:40276011-40276033 CACCCCTTCCTGCTGCAGACAGG + Exonic
1125624966 15:41100870-41100892 CACCCCATTGTGCTCCAGCCTGG - Intronic
1125874809 15:43134199-43134221 CTCCCCATGCTGCCTCTTCCTGG + Intronic
1126654771 15:50965365-50965387 CACCCAATCCTGCCACTGCCAGG - Intronic
1126716550 15:51524553-51524575 AGCACCACGCTGCTGCTGCCAGG - Intronic
1126848226 15:52781508-52781530 CATCCCATGCTTCTGTTGCCAGG - Intronic
1128554743 15:68623694-68623716 CACCCGCTGCTGCTGCTCCTGGG - Intronic
1129257018 15:74339401-74339423 CCCCCCAGGCTGCTGCAGCTAGG - Intronic
1129696465 15:77743156-77743178 TACCCCATGCTCCCCCTGCCAGG + Intronic
1129782850 15:78285464-78285486 CACCCAATGATGCTGATACCTGG - Intronic
1130048100 15:80461591-80461613 CTCCCCATGCCTCTGCTCCCAGG - Intronic
1131260919 15:90887300-90887322 CACCACCAGCTCCTGCTGCCCGG + Exonic
1131588402 15:93720954-93720976 TACTCCATGAGGCTGCTGCCCGG - Intergenic
1131998360 15:98155145-98155167 CAGCCCATGCTGCTGCTGTGTGG + Intergenic
1132668193 16:1091315-1091337 CTCCTGATGCTGCTCCTGCCCGG + Intronic
1132736489 16:1388507-1388529 GACCCCATGCTGACCCTGCCCGG + Intronic
1132746601 16:1438812-1438834 CACCTCATGCTGCCCCTGCAGGG + Exonic
1133134467 16:3700241-3700263 CACCCCATCCTCCTCCTCCCGGG + Intronic
1133237210 16:4392864-4392886 CACCCCTTCCAGCTGCTGGCTGG - Intronic
1136397517 16:30001250-30001272 GACAGCATCCTGCTGCTGCCCGG + Intronic
1138806939 16:60100954-60100976 CATGCCATGCAGCTGCTGCTGGG + Intergenic
1139593851 16:67947228-67947250 CTCCCCATCCTGGGGCTGCCCGG - Intronic
1140567076 16:76056004-76056026 CACACCATGTGGCTGCTGCCAGG + Intergenic
1141764032 16:86046959-86046981 CCCCCCAGGCTGCTGCCTCCCGG - Intergenic
1141889874 16:86919386-86919408 CACCACATCCTGAGGCTGCCTGG - Intergenic
1142099426 16:88263700-88263722 CTGCCCCTGCTGCTGCTGCAAGG - Intergenic
1142286208 16:89172504-89172526 CACCCCAGGCAGCTGCGGCAGGG - Intronic
1142350681 16:89577962-89577984 TGCCCCATCCAGCTGCTGCCAGG + Intronic
1142489096 17:266427-266449 CTCCCCATGCTGCAGGTGGCCGG + Intronic
1142976489 17:3647730-3647752 CACCCCTTCCTTCTCCTGCCAGG - Intronic
1143573785 17:7777861-7777883 GACCCAATGCAGCAGCTGCCTGG - Intronic
1143619264 17:8071893-8071915 CACCCCCTGCTGCTCCTGTGGGG + Intergenic
1143774124 17:9186563-9186585 CACCCCAGGCTGGGGCTGCTGGG - Intronic
1144563419 17:16340578-16340600 CACCACATGCAGCTTCAGCCTGG + Intronic
1144707725 17:17380551-17380573 CAGACCCTGCTTCTGCTGCCTGG + Intergenic
1144739971 17:17576304-17576326 CACCCCTCGGTGCTGGTGCCCGG + Intronic
1144767532 17:17740706-17740728 TCCCCCAGGCTCCTGCTGCCTGG - Intronic
1144839155 17:18174987-18175009 CACCCCAATCTGCTCCTGCCTGG + Intronic
1145201027 17:20944801-20944823 CACCACGTGTGGCTGCTGCCGGG + Intergenic
1145359692 17:22202032-22202054 CACCACATGCAGCTTCAGCCTGG + Intergenic
1145799923 17:27676444-27676466 CACCCCCATCTGCTGCTTCCTGG + Intergenic
1145866998 17:28247929-28247951 CTTCCCATGCTGCTGCCCCCAGG + Intergenic
1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG + Exonic
1147187826 17:38722193-38722215 GCCCCCACGCTGCAGCTGCCAGG + Exonic
1147584755 17:41647855-41647877 CATCCTTTTCTGCTGCTGCCGGG - Intergenic
1147629432 17:41920156-41920178 CCCCCAATCCTGTTGCTGCCAGG + Intronic
1147948446 17:44093471-44093493 CATCTCCTGCTGCTGCTGCAGGG + Exonic
1148063207 17:44850687-44850709 CACTCCATGCTGCTTCTGGGTGG - Exonic
1148330570 17:46811603-46811625 CACCCTGTCCTGCTGCTGCCTGG - Intronic
1148700405 17:49583341-49583363 CACCCCATCTTGCCTCTGCCTGG - Intronic
1148781192 17:50123010-50123032 CAATCCTTGCTGCTGCTTCCAGG - Intronic
1149322240 17:55493363-55493385 AACCCCAGGCTGCTGCTCCAAGG + Intergenic
1149429084 17:56582422-56582444 CAGCCCAAGCTGCAGCTTCCTGG + Intergenic
1149559974 17:57601566-57601588 CCTCCCTTCCTGCTGCTGCCCGG - Intronic
1149993133 17:61393799-61393821 CACCCCCTGCTGCTGGGGCCAGG - Intergenic
1150132318 17:62675804-62675826 CAGCCCATCCTGCTACTGGCTGG + Exonic
1150636187 17:66914962-66914984 CACCCCATGATGCTTCTGTGAGG + Intergenic
1151434932 17:74089282-74089304 CTGCCCATGCTTCTGCTCCCTGG + Intergenic
1151492409 17:74440419-74440441 TACGTCATGCTGCTGCTGCTGGG + Exonic
1152233025 17:79124520-79124542 CAGCCCTTGCTGCTGCTGGCTGG - Intronic
1154340773 18:13500411-13500433 CACCTAACGCTGCTGCTCCCCGG + Intronic
1154981794 18:21508546-21508568 CACATCATGCTGGTGCTTCCCGG + Exonic
1155380361 18:25215831-25215853 CAACCCATGGTACTGGTGCCAGG + Intronic
1155473475 18:26214645-26214667 GACACCATGCTCCTCCTGCCAGG - Intergenic
1156499337 18:37547262-37547284 CACCCAAGGCTGCTCCAGCCTGG - Intronic
1157294594 18:46433498-46433520 CACCCCAGGTTGGTGCTGCCTGG + Exonic
1160030462 18:75253485-75253507 GTTCCCATGCTGCTGCAGCCTGG - Intronic
1160187949 18:76690083-76690105 CACCACCTGCTGCCGCTACCTGG + Intergenic
1160190865 18:76713134-76713156 AACCTGATGCTGATGCTGCCGGG - Intergenic
1160243238 18:77137534-77137556 CACCCCCTGCTGCCTGTGCCTGG + Intergenic
1160476142 18:79190037-79190059 CCCCTCCTGCTGCTGCTGCGGGG - Intronic
1160569035 18:79804058-79804080 CACCCCATGATCGTGCTCCCAGG - Intergenic
1160995548 19:1880551-1880573 GAGCCCATGCTGCTGCTGGCAGG + Intronic
1161062824 19:2223517-2223539 CACCTCCTGCCCCTGCTGCCAGG - Intronic
1161311694 19:3598077-3598099 CACCCCATGCTGTAACTCCCCGG - Intronic
1161949570 19:7460278-7460300 CACCCCATCCTCGTGCAGCCAGG + Intronic
1162242031 19:9362972-9362994 CACCCCTTTCAGCTGCTGGCCGG + Intronic
1162462577 19:10821897-10821919 CTCTCCTTCCTGCTGCTGCCTGG - Intronic
1163117572 19:15197663-15197685 ATCCCCATGCAGCTGTTGCCTGG - Intronic
1163478793 19:17542436-17542458 CACCACATGTGGCTGCTGCCTGG - Intronic
1163915761 19:20239273-20239295 GAACCCATGCTGTTGCTTCCTGG + Intergenic
1164537734 19:29098960-29098982 GCCCCCATGATGCTGCTGGCTGG + Intergenic
1164884977 19:31770688-31770710 CACCCCATGATCCTGCAGCACGG + Intergenic
1165084683 19:33335895-33335917 CACACCATTGTGCTCCTGCCTGG - Intergenic
1166914214 19:46183577-46183599 CACCCCATTGTACTGCAGCCTGG - Intergenic
1167355287 19:48999814-48999836 CACCTCATGCGGCTACTGCGAGG - Intronic
1167671183 19:50854805-50854827 CTCCCCATGCTGCTGGAGGCTGG - Intergenic
1167673954 19:50873323-50873345 CTCCCCATGCTGCTGGAGGCTGG - Exonic
1167697957 19:51026033-51026055 CACCCCAAGCTGCTGGGGCCTGG - Intronic
1168351480 19:55678601-55678623 TGCCCCTTGCTGCTGCAGCCGGG + Exonic
925150628 2:1612426-1612448 AACCCCATGCCCTTGCTGCCTGG + Intergenic
925178359 2:1800457-1800479 CAGGCCATGTGGCTGCTGCCTGG - Intronic
925281770 2:2690111-2690133 CTCCCCATGCTGCAGCCCCCAGG - Intergenic
925588462 2:5486894-5486916 CACACAATGTGGCTGCTGCCAGG - Intergenic
926126958 2:10277827-10277849 CGCCCGATGCTGCCGCTGCCCGG - Intergenic
926322318 2:11757611-11757633 CACCCCAGGCACCTGTTGCCTGG - Intronic
927049607 2:19313914-19313936 CACACCAAGGTGCTGCTGCTTGG + Intergenic
927173119 2:20387020-20387042 CACCACATGATGCTGCAGGCGGG + Intergenic
927697957 2:25250852-25250874 CACCTGCTGCTGCCGCTGCCAGG - Intronic
927836889 2:26406335-26406357 TACCCACTGCTGTTGCTGCCTGG + Intronic
928234345 2:29526983-29527005 CACCCCAGACTCCTGCTCCCTGG - Intronic
928987038 2:37191823-37191845 CACTCCCTGCTGCTGCTCCTGGG - Intronic
929358112 2:41050729-41050751 CACCCCATGAAGTTGCGGCCTGG - Intergenic
929891555 2:45922629-45922651 CACCCCAGGCAGTTGCTGCTGGG - Intronic
930439797 2:51391267-51391289 CACACCATGTAGCTGCTGCTGGG + Intergenic
930971996 2:57407786-57407808 CACAGCATGTGGCTGCTGCCAGG - Intergenic
931637133 2:64351082-64351104 CACACCAAGCCACTGCTGCCAGG - Intergenic
931651088 2:64469448-64469470 CACCCCCTACTACTGTTGCCTGG + Intergenic
931777839 2:65555380-65555402 CAACCCATCCTTCTGCTGCTCGG - Intergenic
932095697 2:68846484-68846506 CACCCCTTGCTGTAGCAGCCTGG + Intergenic
933900055 2:86843134-86843156 CACACCATTCCGCTGCAGCCTGG - Intronic
934167532 2:89307989-89308011 CACCCCATGCTGCTGAGGAATGG + Intergenic
934199743 2:89874457-89874479 CACCCCATGCTGCTGAGGAATGG - Intergenic
934943345 2:98518493-98518515 CCCACAATGCTGCTGCTGCTGGG - Intronic
935780503 2:106506089-106506111 CACACCATTCCGCTGCAGCCTGG + Intergenic
936077769 2:109412566-109412588 CAGCCCCTGCTGGTGCTGCAGGG + Intronic
937527159 2:122785589-122785611 CACCCAATTCTACTGCTGCATGG - Intergenic
938224711 2:129606019-129606041 TACCCCTTGTTGCTGCTTCCTGG + Intergenic
938810653 2:134849798-134849820 CACCCCATGCAGATCCTGGCAGG - Intronic
940905106 2:159162035-159162057 CTCCTCCTGCTGCTGCAGCCTGG - Intronic
941625995 2:167830839-167830861 CACCTCACGCTGCTGCTTCCTGG - Intergenic
942115431 2:172724655-172724677 CACCCCATGAAGCTGCACCCAGG + Intergenic
943226886 2:185188886-185188908 CACACCATGCCCCTGCTGCCAGG + Intergenic
945052416 2:205836580-205836602 CCCCCGCTGCTTCTGCTGCCCGG + Intergenic
945188703 2:207165561-207165583 ACGTCCATGCTGCTGCTGCCGGG + Exonic
946392662 2:219425962-219425984 CACTTCATGCTGCTGCTGTGTGG - Exonic
947937411 2:234020035-234020057 TTTCCCATGCTGCTGCTGCTTGG + Intergenic
948233577 2:236370258-236370280 CACCCCAGGCTGCACCTGCACGG - Intronic
948580933 2:238986724-238986746 CGCCCCATGCGCCTGCTCCCTGG - Intergenic
948667244 2:239544380-239544402 CGCCTCCTCCTGCTGCTGCCTGG + Intergenic
948791947 2:240383704-240383726 CAGCACATGCTGCTGGGGCCAGG - Intergenic
1168803069 20:655887-655909 CACCCCTTACTTCTGCTTCCAGG + Intronic
1168917416 20:1501449-1501471 CACACCATGCTGCCACTGCCAGG + Intergenic
1169207551 20:3748815-3748837 AGCCCCAAGCTCCTGCTGCCAGG + Intronic
1171123043 20:22582186-22582208 CGCGGCCTGCTGCTGCTGCCCGG + Exonic
1171373587 20:24676781-24676803 CACACCTTGGTGCTGCTCCCTGG + Intergenic
1171472714 20:25384833-25384855 CACCCTGTCCTGTTGCTGCCTGG - Intronic
1172095134 20:32456800-32456822 CCCACCCTGCTCCTGCTGCCGGG + Intronic
1172906790 20:38376390-38376412 TTCCCCGAGCTGCTGCTGCCCGG - Intronic
1173527626 20:43745123-43745145 TTCCCCTTGCTGCTGGTGCCTGG - Intergenic
1174230298 20:49040829-49040851 CACCCGGTGCTGCTGCTTTCTGG - Intergenic
1174485398 20:50857940-50857962 CACCCCACAGTGTTGCTGCCTGG + Intronic
1174515339 20:51087806-51087828 ATCCCCATGCTGCTGGTCCCTGG + Intergenic
1174550824 20:51360281-51360303 GACCCCAGGCTGCTACTACCTGG - Intergenic
1175131625 20:56793912-56793934 CACCCCATGCTGATTCTTGCTGG + Intergenic
1175140987 20:56860128-56860150 CACCTCACACTGCTGCTCCCTGG + Intergenic
1175315345 20:58043372-58043394 CACCCCTTCCTGGGGCTGCCGGG + Intergenic
1175457344 20:59125392-59125414 CTCCCCATGCTGATGATGCTGGG - Intergenic
1176052317 20:63126379-63126401 CAGCCCTACCTGCTGCTGCCAGG - Intergenic
1180211798 21:46299342-46299364 CAGGTGATGCTGCTGCTGCCTGG - Intergenic
1180713102 22:17853300-17853322 CAGCCCACTCTGCTGCAGCCTGG + Intronic
1181163586 22:20971759-20971781 CCTCCCAGGCTGCTGCTGCAGGG - Intronic
1181754119 22:25010963-25010985 CACCACAAGCTGCATCTGCCTGG + Intronic
1182804382 22:33058082-33058104 CTCCCCAGGCTGCCGCTGCCGGG - Intronic
1184034862 22:41913594-41913616 CACCCCATGCCACAGCTCCCAGG - Intronic
1184453494 22:44596603-44596625 CAACCCAGCCTGCAGCTGCCTGG + Intergenic
1184505144 22:44895997-44896019 CAGCCCAACCTGCTGCTACCTGG + Intronic
1184665576 22:45987213-45987235 CACCCCCTCCTTCTGCTCCCTGG - Intergenic
1184726147 22:46347801-46347823 CAGCCCCTGCTGCTTCTGCTGGG + Intronic
950025566 3:9817707-9817729 CTTCCCACGCTGCTACTGCCTGG + Exonic
950796054 3:15511551-15511573 CAACCAATGCTGCTCCTGCAGGG + Intronic
951551880 3:23882755-23882777 CACCCTCTGCAGCTGCTGGCTGG + Intronic
952929238 3:38346880-38346902 CGCCCCTCGCCGCTGCTGCCTGG + Exonic
953017524 3:39092471-39092493 CATCCCATGCTGCAGGTGCATGG - Intronic
953543148 3:43840538-43840560 CACACAATGTTTCTGCTGCCTGG - Intergenic
953850747 3:46464060-46464082 CAGCCCTTTCTGCTGCGGCCTGG + Intronic
954369487 3:50162726-50162748 CACGACACACTGCTGCTGCCTGG + Intronic
954674515 3:52308466-52308488 CATCCCCTGGTCCTGCTGCCTGG - Intergenic
955746656 3:62147319-62147341 GAGTCAATGCTGCTGCTGCCTGG + Intronic
957277467 3:78108529-78108551 CACCCCCTGCAGCCGCTGGCCGG - Intergenic
960439670 3:117671309-117671331 CAACCCATCCAGCTGCTGACTGG + Intergenic
960479545 3:118171537-118171559 CACCCTCTGCAGCTGCTGGCCGG - Intergenic
960564805 3:119122201-119122223 CATGCCATGTAGCTGCTGCCAGG - Intronic
961152066 3:124647442-124647464 CTCACAATGCTGCTCCTGCCTGG + Intronic
962151810 3:132901874-132901896 CGCACCATCCTGCTGCTGCTGGG - Intergenic
962483205 3:135815768-135815790 TACACCAGGCGGCTGCTGCCAGG - Intergenic
962688261 3:137868225-137868247 TGCACCATGCTGCTGCTGCTGGG - Intergenic
963100849 3:141602466-141602488 CACCCACTGCTGCTCCTGCTGGG + Intronic
965160793 3:165130135-165130157 CACACCAAGCTGCTGCTGCCAGG + Intergenic
965256975 3:166425703-166425725 CATGCCATGTGGCTGCTGCCAGG - Intergenic
966313152 3:178616517-178616539 TGCACCAAGCTGCTGCTGCCTGG + Intronic
967038732 3:185669819-185669841 CACCCTATGCTGCTGTTCTCAGG + Intronic
967627538 3:191703384-191703406 CAGCTGCTGCTGCTGCTGCCAGG + Intergenic
967879080 3:194286559-194286581 CACTCCATTCTCCTCCTGCCCGG + Intergenic
968490678 4:889120-889142 CACTCCCTGCTCCTGCTGCCTGG - Intronic
968564748 4:1305620-1305642 CACCACATGCTGGTGGAGCCGGG - Intronic
968925456 4:3544890-3544912 AAACCCATGCTGCTTCTGCCTGG - Intergenic
969084914 4:4649086-4649108 CAGCACACACTGCTGCTGCCTGG + Intergenic
969920162 4:10530831-10530853 CACCCCAGCCTGCTCCTTCCAGG + Intronic
970511437 4:16785544-16785566 CACCCGATGCGGCTGCTGCCCGG - Intronic
971633172 4:29021570-29021592 CTCCCCATGCTGCTGTTCTCAGG - Intergenic
971954393 4:33396733-33396755 CTCTCCATGCTGATGATGCCTGG - Intergenic
972165754 4:36281973-36281995 CAGCACATGCAGCTGCTGGCAGG - Intronic
975131917 4:70839667-70839689 CGCCGCCTGCTGCTGCTGCTCGG - Exonic
975740676 4:77426170-77426192 CAGCCCATGCAGCAGCTCCCTGG + Intronic
976016300 4:80559624-80559646 CACACAATGCAGCTTCTGCCAGG - Intronic
976388194 4:84483381-84483403 CACCCCAGGCTGAGGCTGCAGGG + Intergenic
976917983 4:90402537-90402559 CACCCCATGCAACTCTTGCCCGG - Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
978030502 4:103936553-103936575 TGCACCATGCTGCTGCTGCCAGG - Intergenic
978431649 4:108639543-108639565 CTCCACATGCTGCTGATTCCTGG + Intergenic
979427327 4:120584021-120584043 CACACCATGCCACTGCTACCGGG - Intergenic
981049176 4:140293909-140293931 CACCCTAAGCTTTTGCTGCCTGG - Intronic
982545116 4:156724270-156724292 CAGTGCCTGCTGCTGCTGCCTGG + Intergenic
982683495 4:158459990-158460012 CATGCCATACAGCTGCTGCCAGG + Intronic
983421848 4:167527798-167527820 CTCACCATGCTGCTGTTGCCAGG + Intergenic
984243685 4:177248756-177248778 CTCCCCATTCTGCAGCTGCCTGG + Exonic
985492808 5:189217-189239 ACCCCCATGCTCCTGCAGCCTGG + Exonic
985886454 5:2683905-2683927 CAGCCCTCCCTGCTGCTGCCAGG + Intergenic
985947775 5:3200297-3200319 CACACCCTCCTGCTGCTGACAGG + Intergenic
989657517 5:43760422-43760444 GACTCCATGCTGCTCCTGGCTGG + Intergenic
991585452 5:68197041-68197063 CACTCCTTCCTGCTGCTGACTGG - Intronic
992579329 5:78155286-78155308 CATGCCACACTGCTGCTGCCAGG + Intronic
993623196 5:90192286-90192308 TGCACCATGTTGCTGCTGCCAGG - Intergenic
993932324 5:93955005-93955027 CACACCATGCTGCTGCTGCCAGG + Intronic
994145751 5:96393305-96393327 CCCCCTACGCTGCTGCTGCTGGG + Exonic
994428827 5:99628916-99628938 AGCACCTTGCTGCTGCTGCCTGG + Intergenic
995717343 5:115092944-115092966 TAGCCCATGCTGCTGTTACCGGG - Intergenic
997209754 5:132070349-132070371 CACCCCCTGCTGGTCCAGCCAGG + Intergenic
998168210 5:139856438-139856460 TACCCTCTGCTGCTGCTGCTGGG + Intronic
998188384 5:140000706-140000728 CACCTCCTCCTGCTGCAGCCAGG + Intronic
998245976 5:140505740-140505762 CATGCCCTGCTGTTGCTGCCAGG - Exonic
999419821 5:151431301-151431323 CACCCGGAGCTCCTGCTGCCAGG - Intergenic
1001017115 5:168151732-168151754 CAACAGATTCTGCTGCTGCCCGG - Intronic
1001180114 5:169512596-169512618 CACCCTCTGCTCCTGTTGCCAGG + Intergenic
1002058980 5:176615225-176615247 CACCCCCAGCAGCTGCGGCCCGG + Intergenic
1002086203 5:176777135-176777157 CACCCCATGCTCCTGGGGCCAGG + Intergenic
1003438078 6:6112262-6112284 TACACCATGCCACTGCTGCCAGG + Intergenic
1004736183 6:18408720-18408742 CCCGCCATGCAGCTGCAGCCAGG - Intronic
1005494320 6:26375431-26375453 CACCACCAGCTGCTGCTGGCAGG + Intronic
1005882961 6:30074508-30074530 CACCCCTGGCCGCTCCTGCCTGG + Intronic
1006290787 6:33134895-33134917 CACGCCATTCTCCTGCTTCCTGG - Intergenic
1006326762 6:33360119-33360141 AACCACATGCCTCTGCTGCCAGG - Intergenic
1006613955 6:35312259-35312281 CACCACCTGCTGCAGCTACCAGG + Intronic
1007001153 6:38314237-38314259 CACCCCACTGTGCTGCAGCCTGG - Intronic
1007190472 6:40012194-40012216 CATGCCATGTGGCTGCTGCCAGG + Intergenic
1008085154 6:47236602-47236624 CACACCCTGCTGCTGCTTCCAGG + Intronic
1008312048 6:49989000-49989022 CACACCATGATGCTGCTGCTAGG - Intergenic
1008843559 6:55934701-55934723 AAGCCCATTCTGCTTCTGCCCGG - Intergenic
1008848691 6:55997762-55997784 CATGCCATGCAGCTGCTGCCAGG + Intergenic
1008857772 6:56112517-56112539 CACTCCATGCTGCCTCTGCTGGG - Intronic
1009645071 6:66391063-66391085 GACCCCAGGCTGCTTATGCCTGG + Intergenic
1010691007 6:78910893-78910915 CACCCCAAGACGCTGCTGCAGGG + Intronic
1010945576 6:81970045-81970067 CAGCACAGGCTGCTGATGCCTGG + Intergenic
1011340886 6:86313171-86313193 CACACCATGCAGCCTCTGCCAGG - Intergenic
1014276277 6:119393997-119394019 CCCCCCAGGATGCTGCTGCAGGG - Intergenic
1014650421 6:124029730-124029752 CACCTCCTGCTGCTGTTGCCTGG - Intronic
1014692321 6:124577352-124577374 CACACTATGCAGCTGCTGCTGGG - Intronic
1014855658 6:126397407-126397429 CACACCATGTGGCTGGTGCCAGG + Intergenic
1016151038 6:140743893-140743915 TACACCATGCTGCAGCTGCTGGG - Intergenic
1016495711 6:144659576-144659598 CAACCCAGGCTGCTGGTGTCTGG + Intronic
1016567357 6:145471573-145471595 CACACCATGCTGCAGCTGCCTGG - Intergenic
1017012579 6:150072487-150072509 CAGCCTCTGCTCCTGCTGCCAGG + Intergenic
1017725450 6:157273717-157273739 CATCCCTGGCTGCAGCTGCCGGG - Intergenic
1017760414 6:157563646-157563668 CACCGCATGCCCCTGCTGGCTGG - Intronic
1017869919 6:158478638-158478660 CACCCCACCCTGCAACTGCCTGG + Intronic
1018038201 6:159899371-159899393 CACCCCAGGCTGTCACTGCCAGG + Intergenic
1018207111 6:161446087-161446109 CACCCCATGCTCCAGATACCTGG - Intronic
1018394806 6:163370053-163370075 CACCCCATCCTGCTGCTCTGTGG + Intergenic
1018507904 6:164491233-164491255 TGCCCCACCCTGCTGCTGCCTGG + Intergenic
1019173340 6:170147097-170147119 CATGCCAGGATGCTGCTGCCTGG - Intergenic
1019176737 6:170163166-170163188 CACCGACTGATGCTGCTGCCTGG + Intergenic
1019377141 7:698906-698928 CACCAGCTGCTGCTGCTGCGTGG - Intronic
1019634688 7:2069296-2069318 CTCCTCCTGCAGCTGCTGCCTGG + Exonic
1019919049 7:4151182-4151204 GAACCCATGCTGCGGCTCCCAGG + Intronic
1020085436 7:5307771-5307793 CCCTCCAGGCTGCTGCTGCGTGG - Exonic
1020213419 7:6171620-6171642 CACCATCTCCTGCTGCTGCCAGG + Intronic
1022053441 7:26703065-26703087 CAGCCCATGCTGCTGGTCCCAGG + Intronic
1024369235 7:48560371-48560393 CACACCATACAGCTGCTGCAGGG + Intronic
1026024193 7:66732063-66732085 CAGCCCAGCCTGCTTCTGCCAGG + Intronic
1026644797 7:72158283-72158305 CTCCCCACATTGCTGCTGCCAGG - Intronic
1026680850 7:72465521-72465543 CACCCCTGACTGCTGCAGCCAGG + Intergenic
1026888917 7:73970955-73970977 CAGCCCAGCCTGCTTCTGCCAGG + Intergenic
1026903254 7:74048513-74048535 CTGCCGCTGCTGCTGCTGCCTGG - Exonic
1029129205 7:98317518-98317540 CACACCATCCTCCTGCTGGCCGG + Intronic
1029304331 7:99607587-99607609 CACCCCCTGTGGCTCCTGCCTGG - Intronic
1029364146 7:100106576-100106598 CTCCCGAAGCAGCTGCTGCCTGG + Intronic
1029364826 7:100110029-100110051 CTCCCCTTCCTGCTGCAGCCGGG + Exonic
1032267511 7:130379755-130379777 CTGACCCTGCTGCTGCTGCCCGG + Intergenic
1032858496 7:135857252-135857274 CACCCCTCACTGCTCCTGCCTGG - Intergenic
1034432372 7:151047579-151047601 CACACCATGCTGCAACTGCTGGG - Intronic
1034898147 7:154890706-154890728 CACCCCATGCATCTGGAGCCAGG + Intronic
1035200897 7:157265155-157265177 AAGCCCCTGCTCCTGCTGCCAGG + Intronic
1035515340 8:228058-228080 CACGCCAGGATGCTCCTGCCAGG + Intergenic
1035654213 8:1293300-1293322 GAGCCCAGCCTGCTGCTGCCTGG - Intergenic
1035654240 8:1293399-1293421 GAGCCCAGCCTGCTGCTGCCAGG - Intergenic
1036149599 8:6285309-6285331 AACGCCCTGCTGCTGCTGTCAGG - Intergenic
1037816855 8:22116982-22117004 CGCCCCAGGCAGCTGCTACCTGG - Exonic
1037992583 8:23331262-23331284 CAGCCTCTGCTGCTCCTGCCTGG + Intronic
1038865765 8:31437228-31437250 CACCCCCCTCTGCTGCTGTCAGG - Intergenic
1040397771 8:47015726-47015748 CATACCATGATGCTGCTGCTGGG + Intergenic
1042036967 8:64543699-64543721 CATGCCATGATGCTGATGCCAGG - Intergenic
1043600233 8:81928698-81928720 CCCTCCATGCTGGTGCTGGCTGG - Intergenic
1043941151 8:86197340-86197362 CCCCCCTTGCTGCTGTTTCCTGG - Intergenic
1044072335 8:87778111-87778133 CACAGCTAGCTGCTGCTGCCAGG + Intergenic
1044086855 8:87953086-87953108 CACCCCAACCTGCTGCTTTCAGG + Intergenic
1044123737 8:88431427-88431449 GACACCATGCTGCAGCTGCTTGG - Intergenic
1044414741 8:91924865-91924887 CAGCCCATGCTGCTGCTCTATGG + Intergenic
1044932735 8:97265563-97265585 CACACCATCCTGAGGCTGCCGGG - Intergenic
1045035522 8:98173568-98173590 CTGCCCCTGCTGCTGCTGCCTGG - Intergenic
1045296747 8:100878055-100878077 CACCTCATGGAGCTGCTGACCGG - Intergenic
1045312431 8:101014702-101014724 CACTCCATGCCTCTGCTTCCTGG - Intergenic
1046017094 8:108617926-108617948 CGACCCATGCTGGTGCTTCCAGG - Intronic
1046211489 8:111081724-111081746 CACACCATGCTGCTGTTGCCAGG + Intergenic
1046760124 8:118011984-118012006 CTCCTCCTGCTGCTGCTGCTGGG - Intronic
1047835743 8:128688861-128688883 CACCCCTTGATGCTGCTGTGGGG - Intergenic
1047910013 8:129517849-129517871 TGCACCATGCTGCTGCTGCCAGG - Intergenic
1048757295 8:137754076-137754098 CTCTCCAGACTGCTGCTGCCGGG - Intergenic
1049157378 8:141075321-141075343 GACTCCAGGCTGCTGCGGCCAGG - Intergenic
1049586587 8:143435267-143435289 CCCACCCTGCTCCTGCTGCCCGG + Intergenic
1049985588 9:947965-947987 GAGCCCTTGCTGCTGCTGACTGG + Intronic
1050580701 9:7052733-7052755 CAGCCCTTGCTGCTGCTTCAGGG - Intronic
1052338787 9:27345066-27345088 CACCCCATGCTGCTGCATACTGG - Intronic
1052754334 9:32525316-32525338 CACCCGATGCTGTTGCTGTTCGG - Intronic
1053800347 9:41760072-41760094 AAACCCATGCTGCTTCTGCCTGG - Intergenic
1054144851 9:61554763-61554785 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1054188774 9:61972224-61972246 AAACCCATGCTGCTTCTGCCTGG - Intergenic
1054464543 9:65485720-65485742 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1054649747 9:67616393-67616415 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1055438026 9:76311872-76311894 CACCCCATGCAGCCACTACCAGG + Intronic
1055826905 9:80338461-80338483 CATGCCATGTGGCTGCTGCCAGG - Intergenic
1055955916 9:81773436-81773458 CACCCCATCCTCCTCCTCCCGGG + Intergenic
1056889930 9:90482431-90482453 AATCCCATGCTGCTGGTGCCTGG - Intergenic
1056927420 9:90846789-90846811 CACAGCATTCTGCTGCTGGCTGG - Intronic
1057242413 9:93423206-93423228 TTCCCTATCCTGCTGCTGCCTGG - Intergenic
1057906487 9:98987406-98987428 CTCCCCAGGCTGCGGCTGCTGGG - Intronic
1058672003 9:107367700-107367722 CACCCCATGCAGGGGCTGGCTGG - Intergenic
1060414513 9:123420971-123420993 CACCAGATGCGGCTGGTGCCTGG + Intronic
1060759299 9:126234637-126234659 GATCCCAAGATGCTGCTGCCGGG - Intergenic
1060918452 9:127404750-127404772 CAGGCCATGCTGCTGCGCCCTGG + Intronic
1061022210 9:128023206-128023228 TACCCCTTCCTGCTGCTGACTGG + Intergenic
1061445806 9:130636532-130636554 CACTGCTTCCTGCTGCTGCCCGG - Intronic
1062389437 9:136328038-136328060 CACCCCACGGTGCCCCTGCCAGG - Intronic
1062454102 9:136627704-136627726 CTCCCCACGCTGCTGGTGCCAGG - Intergenic
1186344504 X:8677983-8678005 CACCCCAAGCTGTTCCTGCTGGG + Intronic
1187136572 X:16552971-16552993 CACCCCATGTTCCAGCTACCTGG + Intergenic
1187508588 X:19897462-19897484 TCCCACATGCTGCTGCTGCTGGG - Intergenic
1189412013 X:40780645-40780667 CACACCATGCAGCTGCTTCTGGG + Intergenic
1189658128 X:43268085-43268107 CGCACCATGCAGCTGCTGCTGGG + Intergenic
1190594403 X:52038348-52038370 CACACAATGCTGCTGCTGCTGGG - Intergenic
1191207552 X:57850401-57850423 TATACCATGCTGCTACTGCCGGG + Intergenic
1191774721 X:64801513-64801535 TACACCATGCTGCTGCTGCTGGG - Intergenic
1191957347 X:66658564-66658586 CACACCATTCTGCTGCTTCCTGG - Intergenic
1192726052 X:73753158-73753180 CACACCACGCTGCTGCTGCCAGG + Intergenic
1193147624 X:78093432-78093454 CACACCATGCTTTTGCTACCAGG + Intronic
1193856834 X:86612652-86612674 CACACCAGGTGGCTGCTGCCAGG + Intronic
1193952444 X:87817187-87817209 CACCCCATCCTCCTCCTCCCAGG + Intergenic
1194551976 X:95311819-95311841 CACACAATGCTGCTGCTGCCAGG + Intergenic
1194787737 X:98107021-98107043 CCCCCCACACTGCTGCTGCCAGG + Intergenic
1195172492 X:102282391-102282413 CACACCATGCTGCTGTGGCCAGG + Intergenic
1195186374 X:102404704-102404726 CACACCATGCTGCTGTGGCCAGG - Intronic
1195738011 X:108033426-108033448 CTCCTCATGCTGCTGCACCCAGG + Intergenic
1196461492 X:115936238-115936260 AGCACCATGCTGCTGCTGCCAGG + Intergenic
1196609440 X:117695029-117695051 CACACCATGCTTCCGCTGCCTGG - Intergenic
1196857693 X:119999573-119999595 CTCCTCAGGCTGCTGCTGCCAGG + Intergenic
1196859588 X:120014921-120014943 CTCCTCAGGCTGCTGCTGCCAGG + Intergenic
1196984659 X:121254649-121254671 CACACCATGCTGGTGATGCTGGG + Intergenic
1197108101 X:122739949-122739971 TTCCCCCTGCTGGTGCTGCCTGG - Intergenic
1197112796 X:122796906-122796928 TTCACCATACTGCTGCTGCCAGG - Intergenic
1197399576 X:125974056-125974078 CACACCATGCTGCTGCTACAGGG - Intergenic
1197602748 X:128548910-128548932 TACACCATGCTGCCGCTGCTAGG + Intergenic
1197609609 X:128623522-128623544 CAAGCCATGCTGTTGCAGCCTGG - Intergenic
1197796659 X:130305480-130305502 CAGCACCAGCTGCTGCTGCCCGG + Intergenic
1197987307 X:132279499-132279521 CGCACCACGCTGCTGCTGCTGGG + Intergenic
1198578396 X:138036328-138036350 CTCACCATGCATCTGCTGCCAGG - Intergenic
1199440848 X:147866437-147866459 CACCCCATGCTGCTGCTGCAGGG - Intergenic
1199593451 X:149488715-149488737 CAGCCTGTGCTGCTGCAGCCAGG + Intronic
1199598566 X:149526716-149526738 CAGCCTGTGCTGCTGCAGCCAGG - Intronic
1199798846 X:151229710-151229732 CACTCCATGATGCTGCTGTAAGG + Intergenic
1200086570 X:153610142-153610164 CACCCCATCCCCCTGCTGCTGGG + Intergenic
1200572007 Y:4843531-4843553 CACACCAGGCTGCCGCTGCTGGG - Intergenic
1201405108 Y:13642213-13642235 CACACCATACTGCCCCTGCCAGG - Intergenic
1202200108 Y:22337328-22337350 GAACCCATGCAGTTGCTGCCTGG - Intronic