ID: 1145881034

View in Genome Browser
Species Human (GRCh38)
Location 17:28352880-28352902
Sequence CTCAAGAAGGGGAGGTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 512}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145881034_1145881040 -3 Left 1145881034 17:28352880-28352902 CCATTCCACCTCCCCTTCTTGAG 0: 1
1: 0
2: 3
3: 52
4: 512
Right 1145881040 17:28352900-28352922 GAGAGAGATTACCTTTTGTCTGG 0: 1
1: 0
2: 1
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145881034 Original CRISPR CTCAAGAAGGGGAGGTGGAA TGG (reversed) Intronic
900619511 1:3580414-3580436 CCCAGGGAGGGGAGGAGGAAAGG + Intronic
900875149 1:5337186-5337208 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
900937032 1:5772769-5772791 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
901939704 1:12652585-12652607 CTCAAGAAAAGGAAGTGGGATGG + Intronic
902566326 1:17314090-17314112 CTCAAGAGGGGAAGGGAGAAGGG - Intronic
902567180 1:17319459-17319481 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
902954910 1:19919049-19919071 CACAGGAAGAGGAGGAGGAAAGG - Intergenic
903226027 1:21894624-21894646 CTCAGGAAGGGCAGGTGGGCTGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903942967 1:26944314-26944336 CTCAGGAAGCTGAGGTGGGAGGG - Intronic
904530867 1:31168230-31168252 CTCAAGAGGTGGAGGTTGCAGGG - Intergenic
905229166 1:36502694-36502716 CTCAGGAGGCTGAGGTGGAAGGG - Intergenic
905598473 1:39229850-39229872 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
905603326 1:39273040-39273062 GTCAAGATGGGGAGGAGGAAGGG - Intronic
906579941 1:46927959-46927981 CTCAAGCCTGTGAGGTGGAAGGG - Intergenic
906603781 1:47150928-47150950 CTCAAGCCTGTGAGGTGGAAGGG + Intergenic
906690085 1:47786805-47786827 CTCAAGAGGCTAAGGTGGAAGGG - Intronic
907286167 1:53381284-53381306 CTCAGGAGGCTGAGGTGGAAGGG - Intergenic
907311319 1:53540679-53540701 CTCAGGAAAGGGAGGTGGCTGGG - Intronic
907448993 1:54530293-54530315 CTCAGGAAGCTGAGGTGGGAGGG - Intergenic
907602533 1:55785282-55785304 ATCAGGAAGAGCAGGTGGAACGG - Intergenic
910330299 1:86065684-86065706 CTCAAGATGCTGAGGTGGGAGGG + Intronic
910649506 1:89550470-89550492 CTGAAGAAGGTGAGATGAAAAGG - Intronic
910672774 1:89789779-89789801 CTCAGGAAGCTGAGGTGGAAGGG - Intronic
910750270 1:90621484-90621506 CTCAAGAAGAAGAGGGAGAAAGG - Intergenic
912060094 1:105657771-105657793 CTCAGGAAGGGGAGGTAGTTTGG + Intergenic
912817450 1:112840709-112840731 CTCAGGAAGTTGAGGTGGGAGGG + Intergenic
915251479 1:154592275-154592297 CTTAGGAAGGAGAGGGGGAAGGG - Intronic
915349880 1:155217691-155217713 CTGAAGAAGATGAGGAGGAAGGG - Intergenic
915353222 1:155239602-155239624 CTGAAGAAGGTGAGGAGGAAGGG - Exonic
915520485 1:156439566-156439588 CGAAAGAGGGGGAGGGGGAAAGG + Intergenic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
916210812 1:162358240-162358262 CTCAAGGTGGAAAGGTGGAAAGG - Intronic
916452846 1:164937785-164937807 CTCAGGAAGGGGATGAGGGAAGG - Intergenic
917106642 1:171498907-171498929 CTCAGGAGGCTGAGGTGGAAGGG - Intronic
917363015 1:174197722-174197744 CTCAAGAGGCGGAGGTTGCAGGG + Intronic
917536292 1:175876974-175876996 CTGAAGATGGGGAGGTGGCAGGG - Intergenic
917564929 1:176203872-176203894 CTCAAGGAGGGGAGAAGGACAGG + Intronic
919147719 1:193656052-193656074 CTCAAGAGAGGGAGGTGGCCGGG - Intergenic
919939041 1:202273855-202273877 TTCAACAAGGAGAGATGGAAAGG - Intronic
920349944 1:205331307-205331329 GGTAAGAAGGGGAGGTGGGAAGG + Intergenic
921405572 1:214775590-214775612 CTCAGGAAGCTGAGGTGGGAAGG + Intergenic
921791938 1:219300089-219300111 CTCAAGAGGCTGAGGTGGGATGG - Intergenic
921921597 1:220676214-220676236 GTTAAGACTGGGAGGTGGAAGGG - Intergenic
922160650 1:223077416-223077438 CACAAGAAGGGGAGGGGGCGTGG - Intergenic
922638184 1:227198348-227198370 CTCAAGAGGCTGAGGTGGGAGGG + Intronic
923196075 1:231668936-231668958 CTAAAGAAGGGAAGGCTGAAAGG - Intronic
923593978 1:235345922-235345944 ATCTAGAAGGGAAGATGGAATGG - Intergenic
924140837 1:241021645-241021667 GTCAAGGGGAGGAGGTGGAAGGG + Intronic
924772497 1:247089510-247089532 CTTCAGCTGGGGAGGTGGAAAGG - Intergenic
1063595846 10:7434923-7434945 CTGAAGAATGGGAGGTGCCAGGG - Intergenic
1064460353 10:15529091-15529113 CTCAAGAAAGGAAGGAAGAAGGG - Intronic
1064462011 10:15544188-15544210 CTCAGGAAGCTGAGGTGGGAGGG + Intronic
1065404533 10:25349271-25349293 CTCATGAAGGGAAGGTAGGAGGG - Intronic
1065796366 10:29311954-29311976 GTCAAGAAAGGGAAGGGGAAGGG + Intronic
1065939503 10:30551376-30551398 CTCAGGAAGCTGAGGTGGAAGGG - Intergenic
1066413911 10:35201315-35201337 CTTAAGGAGGGGAAGAGGAAGGG + Intronic
1067141485 10:43660940-43660962 CTCAGGAAGCTGAGGTGGGAGGG - Intergenic
1067771827 10:49132013-49132035 ATCAAGAGGCAGAGGTGGAACGG - Exonic
1068897193 10:62219057-62219079 CAAAAGAAGGGGAGGAGGAAGGG - Intronic
1069726952 10:70586254-70586276 CTGAAGATGAGGAGGTGGGAGGG + Intergenic
1070103496 10:73411291-73411313 CTCAGAAAGGGGAGGGTGAAAGG + Intronic
1070749336 10:78954729-78954751 AACAAGAAGGTGAGCTGGAAGGG + Intergenic
1070900503 10:80023962-80023984 CTCCAAAAGAGGAGGAGGAAGGG + Intergenic
1070902250 10:80039843-80039865 CTCCAAAAGAGGAGGAGGAAGGG + Intergenic
1072108026 10:92291836-92291858 CACAAGTTGGGGAGGGGGAAGGG - Intronic
1072303170 10:94081877-94081899 CACAAGCAGGCAAGGTGGAAAGG - Intronic
1072741514 10:97912742-97912764 CTGAAGGAGGGGAGGTGCAGAGG - Intronic
1073849967 10:107603396-107603418 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
1074990347 10:118700415-118700437 CTCAAGAATGGGAAGAGGAGAGG + Intronic
1075141424 10:119840220-119840242 CTCAAGAAGCAGAAGTGGACTGG - Intronic
1076232586 10:128834334-128834356 AACAAGAAGAGGAGGTGGCAGGG + Intergenic
1077370938 11:2181280-2181302 CACACAATGGGGAGGTGGAAGGG + Intergenic
1077987215 11:7365215-7365237 CTCAAGATGGGGTGGGGAAATGG + Intronic
1078673260 11:13383847-13383869 ATCAAGGAGGGAAGGAGGAAAGG + Intronic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1078921172 11:15832072-15832094 CCCAGTAAGGGGAGGTGGGAAGG + Intergenic
1078943696 11:16038434-16038456 AAAAAGAAGGGAAGGTGGAAAGG + Intronic
1079041376 11:17063478-17063500 CTGAAGGAGGGGAGTTGGAAAGG - Intergenic
1079058424 11:17227357-17227379 GACAAGAAGGGGAGGTAGAAAGG + Intronic
1079346031 11:19653065-19653087 CTCAAGAAGGGAATGGAGAAAGG - Intronic
1080055563 11:27902904-27902926 TAGAAGAAGGGGAGGTGGCAAGG + Intergenic
1080556272 11:33420334-33420356 CTCTAGAAGCTGAGGTGGGAGGG - Intergenic
1081175991 11:39927088-39927110 CTCAAAAAGACTAGGTGGAAAGG - Intergenic
1081458310 11:43247111-43247133 ATCAAGAAGGGAAGGAGGCATGG + Intergenic
1082777454 11:57258065-57258087 AGGAAGAAGGGGAGGTGAAAAGG + Intergenic
1082877220 11:58000638-58000660 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
1083447031 11:62715136-62715158 CTCAAGCAGGGGTGGGGGAGGGG - Exonic
1083696629 11:64447805-64447827 GCCAGGAAGGGGAGGGGGAAAGG - Intergenic
1084144360 11:67256243-67256265 CTCAACAAAGGGCGGTGGAGCGG - Exonic
1084594522 11:70109070-70109092 CTCAAGAAGGAGGGGAGGAAAGG - Intronic
1084754352 11:71225487-71225509 TTCCACAAGGGAAGGTGGAAAGG - Intronic
1084912297 11:72400588-72400610 CTAAAGAAGGAGAGGTGGAGAGG - Intronic
1085535565 11:77215256-77215278 CTCAGGGAGGGGAAGTGGAAGGG + Intergenic
1086259625 11:84923465-84923487 CTCAGGAAGGAGGGGGGGAAAGG + Intronic
1087804662 11:102542967-102542989 CTCAGGAAGGAGAGTAGGAAAGG - Intergenic
1087882451 11:103433920-103433942 TTCAAAAAGGGAAGATGGAAAGG + Intronic
1089307522 11:117536011-117536033 CACAAGAAGGGGGGGAGGGAGGG - Intronic
1089418191 11:118310974-118310996 CTCAAGAAGGAAAGGAGGAAAGG + Intronic
1089697588 11:120225638-120225660 CTGAAGAAGGGCAGGAGGATGGG - Intronic
1089995039 11:122898547-122898569 CTCAGGAGTGGGATGTGGAAAGG - Intronic
1090107948 11:123871779-123871801 CGGAAGCAGGGTAGGTGGAAAGG - Intergenic
1090138621 11:124228203-124228225 CTCAGGAAGTTGAGGTGGAAGGG + Intergenic
1090185201 11:124734450-124734472 CTGAGGAAAGGGAGGTGGAAAGG + Intergenic
1090515001 11:127415745-127415767 GTCAATAAGGGGAGGATGAAAGG - Intergenic
1091010946 11:131999930-131999952 CGCAGGAAGGGGAGGAGGAGAGG - Intronic
1091742961 12:2973177-2973199 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1092680074 12:10969104-10969126 AGCAGGAAGGGGAGCTGGAAAGG + Intronic
1092727326 12:11498902-11498924 CTGAAGAATGGGAAATGGAAAGG + Intronic
1092863218 12:12737600-12737622 CTGGAGAAGGGGAGGAGGAGAGG - Intronic
1092871284 12:12808004-12808026 CTCCAGAAGGAGAGGTCGAAGGG - Intronic
1093791407 12:23254674-23254696 CTCAGGTAAGGGAGGTGGAGAGG + Intergenic
1094416981 12:30227361-30227383 CTCAAAAGGGGGAGGCGGGAGGG + Intergenic
1094537411 12:31334474-31334496 CTCCAGAGGCTGAGGTGGAAGGG - Intergenic
1095271955 12:40229100-40229122 CTTAACAAGGGGATGTAGAAAGG + Intronic
1095969748 12:47893512-47893534 TTCAATAAGGGCAGATGGAAGGG + Intronic
1096068897 12:48763279-48763301 CTCAGGAAGCTGAGGTGGGAAGG - Intergenic
1096518913 12:52173305-52173327 ACCCAGAAAGGGAGGTGGAAGGG - Intronic
1096572494 12:52531692-52531714 TCCAGGAAGGGGAGGTGGAAGGG - Intergenic
1096781054 12:53992333-53992355 CTATAGAAGGGGAAGGGGAAAGG - Intronic
1097235588 12:57537224-57537246 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
1097997917 12:65910130-65910152 CACAAAGAGGGGAGGTGGACAGG - Intronic
1098393010 12:69989393-69989415 CTCAAGGGAGGAAGGTGGAAGGG + Intergenic
1100180044 12:92075095-92075117 CACTAGAAGGGGAGGTTGAATGG + Intronic
1100305923 12:93350182-93350204 CTCAAGAGGGGAAGGTGGTAAGG + Intergenic
1100710473 12:97250930-97250952 TTCAAGAAGAGGATGGGGAATGG - Intergenic
1101347603 12:103900956-103900978 CTCAAGTTGGTGATGTGGAATGG - Intergenic
1101463885 12:104926974-104926996 CTCAAGAGGCTGAGGTGGGAGGG + Intronic
1102537184 12:113590265-113590287 TGCAGGAAGGGGAGGTGGAGAGG + Intergenic
1103139115 12:118533454-118533476 ATGGAGAAGGGAAGGTGGAAAGG + Intergenic
1103279164 12:119740832-119740854 CTCAAGGAAGGGAGGAGGGATGG + Intronic
1103516563 12:121512206-121512228 CTCCAGAAGGGCAGGTTGTAGGG + Intronic
1104265865 12:127231972-127231994 CTCAGGAAGGAGAGCTGGAAAGG - Intergenic
1104356826 12:128094327-128094349 CCCAGGAAGGGGAGGTTGCAGGG - Intergenic
1104902282 12:132195991-132196013 CTCCAGAGGGGCAGGTGGGAGGG - Intergenic
1105527611 13:21190680-21190702 CTCAGGAAGCTGAGGTGGGAGGG - Intergenic
1106369259 13:29115704-29115726 CTAAGGAAGGAGAGGTGGACTGG + Intronic
1108077972 13:46701411-46701433 CTCAATAAAGGGTGGTGAAAGGG - Intronic
1109710575 13:66153418-66153440 CTTAGGAAGTGGAAGTGGAAAGG + Intergenic
1109793431 13:67279112-67279134 ATCAGGAAGGGGAGCTGAAAAGG - Intergenic
1111235817 13:85406183-85406205 AGCAGGAAGGGGAGCTGGAAAGG + Intergenic
1112431907 13:99357765-99357787 CTAATGAAGGCGGGGTGGAAGGG - Intronic
1113815074 13:113163835-113163857 TTCAAGGAGGGGACGTGGGATGG - Intronic
1113926979 13:113947087-113947109 CTACAGAAGGTGAGGTGGAGCGG + Intergenic
1114285924 14:21243095-21243117 CTCAAAAAGGAGAGGTGGGGGGG + Intronic
1115641443 14:35337923-35337945 CTAATGAAGGAGAGGTGGGAGGG + Intergenic
1116526355 14:45910594-45910616 CAGCAGAAGGGGAGCTGGAAAGG - Intergenic
1118302341 14:64626710-64626732 TTCAAGAGGGTGAGGTGGAGGGG + Intergenic
1118586578 14:67359356-67359378 CTCAATAAGGGTATGTGGAATGG + Intronic
1118762873 14:68891146-68891168 GTCTAGAAGGGGAGGGTGAAAGG - Intronic
1119644613 14:76339451-76339473 CCCAAGAGGTGCAGGTGGAAGGG - Intronic
1119913317 14:78371378-78371400 CAGCAGAAGGGGAGGTGGAAGGG - Intronic
1120010341 14:79406303-79406325 CTCAAGAAAGAGAGGAGGAGAGG - Intronic
1120037918 14:79718940-79718962 ATCAAGAGTTGGAGGTGGAATGG - Intronic
1120816847 14:88869753-88869775 CTTCAGAAGGGGTGGCGGAAGGG - Intronic
1121129054 14:91428679-91428701 CTAGAGCAGGGGAGGTGGAGAGG + Intergenic
1121145600 14:91579472-91579494 GGCAGGAAGGGGAGTTGGAAGGG - Intergenic
1121823275 14:96989066-96989088 CTCAAGTAGAGGAGCTGGGAAGG + Intergenic
1121837687 14:97106752-97106774 CGCCCGCAGGGGAGGTGGAAAGG + Intergenic
1122720462 14:103719049-103719071 ATCAAGCTGGGGAGGTGGGATGG + Intronic
1123735186 15:23177343-23177365 CCCAAGAGGTGGAGGTGGCAGGG + Intergenic
1124285701 15:28398649-28398671 CCCAAGAGGTGGAGGTGGCAGGG + Intergenic
1124297001 15:28513011-28513033 CCCAAGAGGTGGAGGTGGCAGGG - Intergenic
1126915683 15:53463756-53463778 CTCAGGAAGGTGAATTGGAAGGG - Intergenic
1127186979 15:56490382-56490404 CTCAGGAGGCTGAGGTGGAAGGG + Intergenic
1128040246 15:64565954-64565976 CTCAAGAGGTTGATGTGGAAGGG - Intronic
1128489192 15:68129168-68129190 CTCAGGAGGGTGAGGTGGGAAGG - Intronic
1129187847 15:73921376-73921398 CTGGAGAAGGGGAGGTGGTGTGG - Intergenic
1129230410 15:74194084-74194106 CTCGAGAAGGGGAAGTGGGCAGG - Intronic
1129411876 15:75354779-75354801 CCCAAGAAGGGGAGGAGGAAGGG + Exonic
1129689569 15:77705582-77705604 ACCAAGAAGGTGAGGTGGCAGGG + Intronic
1130420806 15:83745206-83745228 ATCAGGAAAGGGAGCTGGAAAGG - Intronic
1131134622 15:89924343-89924365 CTCAACAAAGGGATGGGGAAGGG + Intergenic
1131335094 15:91541346-91541368 CTCAAGCTGGGGAAGTGGCATGG - Intergenic
1131449212 15:92525340-92525362 GACAAGAAGGGGAGGAAGAAAGG - Intergenic
1132070946 15:98776110-98776132 CTCCCGAAGGGAGGGTGGAAGGG + Intronic
1132307066 15:100823828-100823850 CCCAGGAAGGGGAGGGGGCAAGG + Intergenic
1132969631 16:2680112-2680134 CTGAAGGTGGGGGGGTGGAAGGG - Intergenic
1133225604 16:4338950-4338972 TTACAGATGGGGAGGTGGAAGGG - Exonic
1133489466 16:6253064-6253086 ATCAAGAAGGAGAGATGGCAGGG - Intronic
1133749387 16:8712953-8712975 CACAAGATGGGGAGGGGGTATGG - Exonic
1133984346 16:10656846-10656868 CTCAGGAGGTGGAGGTGGGAGGG - Intronic
1134222633 16:12367031-12367053 ATGATGAAGGGGAGATGGAAAGG - Intronic
1134476604 16:14579460-14579482 CTCAAGAGACTGAGGTGGAAGGG + Intronic
1134765694 16:16755727-16755749 CTCAGGGAGGGGAAGGGGAAGGG - Intergenic
1134826395 16:17287792-17287814 CTAAAGAAGGGGTGGAGGACTGG + Intronic
1135244487 16:20843863-20843885 CTAAAGAAGGGGTTGGGGAAAGG - Intronic
1135250806 16:20900105-20900127 TTCGAGAAAGGGGGGTGGAAAGG - Intronic
1135629668 16:24026185-24026207 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
1135921397 16:26652034-26652056 TTGCAGAAGTGGAGGTGGAAGGG - Intergenic
1136116064 16:28095562-28095584 CTGAGGAAGGGGATGGGGAAAGG - Intergenic
1136119708 16:28124482-28124504 TACAAGAAGAGGAGGAGGAACGG + Intronic
1136474635 16:30505164-30505186 CTCATGAAGGAGAGCTGGAGGGG - Intronic
1136568279 16:31082620-31082642 CTCTACTAGGGGAGGTGGAGAGG - Intronic
1138094593 16:54202049-54202071 CTCAAAAAGGGCAGGTGTGAGGG - Intergenic
1138112778 16:54337715-54337737 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
1139478658 16:67216142-67216164 CTGAAGAAGGAGCAGTGGAAAGG - Intronic
1140324786 16:73991211-73991233 AGCAAGAAGGGGAGTTGGAAAGG + Intergenic
1141763299 16:86043167-86043189 CCCAAGAACAGGAGGTGGCAGGG + Intergenic
1142301753 16:89262712-89262734 AGCAGGAAGGGGAGCTGGAAAGG + Intergenic
1142426048 16:90002870-90002892 TGCCAGAAGGGAAGGTGGAATGG + Intergenic
1142608725 17:1096483-1096505 CTCAGGGAGGAGAGGAGGAAGGG + Intronic
1142745833 17:1957538-1957560 CTCAACAAAGTGAGGTGGCAGGG + Intronic
1142774877 17:2129216-2129238 CTCAGGAGGGTGAGGTGGGAGGG + Intronic
1143279864 17:5745734-5745756 TTCTAGAAGGTGAGCTGGAAAGG + Intergenic
1143431745 17:6893273-6893295 TTCAACATGAGGAGGTGGAAGGG + Intronic
1143569710 17:7748601-7748623 CTCAGGAAGCTGAGGTGGGAGGG - Intronic
1143610656 17:8015856-8015878 GACAAGACGGGGAGGTGGGAGGG + Intronic
1143871312 17:9959018-9959040 CAGGAGAAGGGGAGGTGGGAGGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1143990356 17:10954454-10954476 CTCAGGCAGGGGAGGTGGGCAGG - Intergenic
1144187922 17:12813930-12813952 ACCAAGAAGGTGAGGTCGAAGGG - Intronic
1145881034 17:28352880-28352902 CTCAAGAAGGGGAGGTGGAATGG - Intronic
1146015920 17:29233493-29233515 CTCAGGAGGGGAGGGTGGAAGGG - Intergenic
1146034225 17:29391240-29391262 CACCGGAAGGGGTGGTGGAAGGG + Intronic
1146124042 17:30218128-30218150 CTTCAGCAGGGGACGTGGAATGG + Exonic
1146270414 17:31481678-31481700 TCCAAGAAGAGGAGGTGGCAGGG - Intronic
1146746830 17:35338413-35338435 CTCAGGAAGCTGAGGTGGGATGG + Intergenic
1146806125 17:35866514-35866536 CTCTACAAAGGGAGGTGGACAGG + Intronic
1147138919 17:38450891-38450913 CTCAGGAAGATGAGGTTGAATGG + Intronic
1147365795 17:39958325-39958347 CTGAACAAAAGGAGGTGGAATGG - Intergenic
1147678044 17:42220688-42220710 CTCAGGAAAGGGAGGCCGAAGGG + Intronic
1147688002 17:42298884-42298906 CTCAGGAAAGGGAGGCCGAAGGG - Intronic
1147748229 17:42709268-42709290 TTCAAGATGGGGAGGTGGGAAGG + Intronic
1148119366 17:45198662-45198684 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
1148509843 17:48159045-48159067 ATCTAGAAGGGGAGGTGAGATGG - Intronic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1149515660 17:57279087-57279109 CTCTGGAAGGGAAGGTGGAAAGG + Intronic
1149824991 17:59820090-59820112 TTCAAGAAGAGGAGGAGAAAGGG - Intronic
1149876485 17:60238862-60238884 CTCACGAAGCTGAGGTGGGAGGG + Intronic
1150158482 17:62873928-62873950 GACAGGAAGGGGAGGAGGAAGGG - Intergenic
1150172425 17:63012757-63012779 CTCCAGAATCTGAGGTGGAAGGG - Intronic
1150530263 17:65973712-65973734 CTGGATATGGGGAGGTGGAAAGG + Intronic
1150686464 17:67325112-67325134 AGCAGGAAGGGGAGGTGAAAAGG - Intergenic
1150737751 17:67754780-67754802 CACAAGAAGGAGAGGAGGTAGGG - Intergenic
1151125149 17:71836813-71836835 CTCAAGAAGGGGTGGGTGCAGGG + Intergenic
1151244736 17:72785633-72785655 CGTAGGAAGGGAAGGTGGAAGGG + Intronic
1151368480 17:73631952-73631974 ATTAAGAGGGGGAGGTGGGAGGG + Intronic
1151392261 17:73795415-73795437 CTGAAGAATGGGAAATGGAAGGG + Intergenic
1151823963 17:76513186-76513208 CTCAAGAGGAGGAGGAGGAAGGG + Intergenic
1152893460 17:82896090-82896112 CTGAAGAAGGGGGTGTGGGAGGG - Intronic
1155425523 18:25702590-25702612 CTCAGGAGGCTGAGGTGGAAGGG + Intergenic
1155491744 18:26406894-26406916 CTGAGGAAGGGGAGCAGGAAGGG + Intergenic
1155503151 18:26506685-26506707 CTGGAGAAGAGGAGGTAGAAAGG + Intronic
1155650291 18:28133038-28133060 TTCAAGAAGGGCAGTTTGAATGG - Intronic
1156400641 18:36736502-36736524 AGCAAGAAGGAGAGCTGGAAAGG + Intronic
1156549444 18:37999987-38000009 CTCAAGAAGCTGAGGTGGGAGGG + Intergenic
1157697869 18:49738035-49738057 CACCAGAAGTGGAAGTGGAAAGG - Intergenic
1157756049 18:50218762-50218784 ATCCAGAAGGGGAGGAGGACAGG - Intergenic
1157973420 18:52297798-52297820 CTCAGGAGGCTGAGGTGGAAGGG + Intergenic
1158188295 18:54796502-54796524 AGCCAGAAGGGGAGATGGAATGG + Intronic
1158423104 18:57313430-57313452 AGAAAGAAGGGGAGGGGGAAGGG + Intergenic
1159777503 18:72620383-72620405 AGCAGGAAGGGGAGCTGGAAAGG + Intronic
1160365282 18:78319358-78319380 CTCAAGAAGGGCGGGTGGCCTGG - Intergenic
1160391058 18:78533505-78533527 CTCCAGGAGGGCAGGTGGATTGG - Intergenic
1161576351 19:5056699-5056721 CTTAAGAAAGGGAGGTGGCTGGG - Intronic
1161672603 19:5622516-5622538 CTCAAGAAGGTGAGGCGGCGCGG - Exonic
1161821623 19:6533748-6533770 CTCTGGAGGGGGAGGGGGAAGGG - Intronic
1162542016 19:11302824-11302846 CTCAAGAGGCTGAGGTGGGAAGG - Intronic
1162839982 19:13349333-13349355 CCCAAGGAGGGGATGTGGAGGGG - Intronic
1163107482 19:15133801-15133823 CTGTAGAAGTGGAGATGGAAAGG + Intergenic
1163406022 19:17122978-17123000 CTCAAGAGGTTGAGGTGGGAGGG + Intronic
1164700563 19:30281289-30281311 CTAAAGAAGGGAAGGCTGAATGG - Intronic
1164985511 19:32645544-32645566 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1165255777 19:34576660-34576682 CCCCAGAAGGGCGGGTGGAAGGG - Intergenic
1166864686 19:45828814-45828836 CTCCAGAGGGGGAGGAGGAGAGG + Intronic
1167434152 19:49469355-49469377 CTCAGGAAGCTGAGGTGGGACGG - Intronic
924982607 2:236302-236324 CTCGAGAAGCGGAGCTGGGATGG - Intronic
925043960 2:756796-756818 CTCACAGTGGGGAGGTGGAAGGG - Intergenic
926449037 2:12980033-12980055 GTCAAGAATGGGATGTGCAAAGG - Intergenic
927589308 2:24339361-24339383 CTCAGGAAGCTGAGGTGGGAGGG + Intronic
927699644 2:25259717-25259739 CTGGAGAAGGGGTGGGGGAAGGG - Intronic
928108737 2:28489669-28489691 CCCAAGAAGGGGAGAAGGAAGGG + Intronic
928183013 2:29082996-29083018 CTCAAGAAGCTGAGGTGAGAGGG - Intergenic
929521359 2:42654720-42654742 CTCAGGAAGCTGAGGTGGAAAGG - Intronic
929810844 2:45188232-45188254 CCCAAGAAGGGGAGATGGTGAGG - Intergenic
929983106 2:46699218-46699240 GTGAAGAAGGGGAGGCGGCAGGG + Intronic
930032880 2:47069170-47069192 CCCAGGAAGGGGAGGAGAAAAGG + Intronic
930870732 2:56168229-56168251 CAAAAAAAGGAGAGGTGGAAGGG - Intergenic
931563139 2:63585932-63585954 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
931992123 2:67801314-67801336 CTCAGGAAAGGAAGATGGAAAGG + Intergenic
932965559 2:76471041-76471063 CTCATGAAGGAGAGATTGAATGG + Intergenic
934161098 2:89250434-89250456 CTCACGTTGTGGAGGTGGAAGGG - Intergenic
934206179 2:89931999-89932021 CTCACGTTGTGGAGGTGGAAGGG + Intergenic
934577210 2:95410578-95410600 CACATCAAGGTGAGGTGGAAAGG + Exonic
934700281 2:96434119-96434141 CTTTAGATGGTGAGGTGGAAAGG - Intergenic
934794143 2:97086125-97086147 CACATCAAGGTGAGGTGGAAAGG - Exonic
935175906 2:100648530-100648552 AGCAGGAAGGGGAGCTGGAAAGG - Intergenic
935418622 2:102844180-102844202 CTCCTGAATGGGAGGTGGGATGG + Intergenic
935696893 2:105778019-105778041 CTGAAGAAGGTGAGGAGAAAAGG - Intronic
936657624 2:114506343-114506365 AGCAGGAAGGGGAGCTGGAAAGG - Intronic
937177017 2:119948329-119948351 CTAGAGATGGGGAGGTGGTAGGG + Intronic
937703228 2:124887813-124887835 GTCAGGCAGTGGAGGTGGAATGG + Intronic
939217627 2:139260086-139260108 CTCAAGAGGTGGAACTGGAAGGG + Intergenic
940157921 2:150678695-150678717 CAAAAGAAGGGGAGGTGCTATGG + Intergenic
942418089 2:175779600-175779622 CTCAACCAGAGGAAGTGGAATGG - Intergenic
943592861 2:189820403-189820425 CTCAGGAGGCTGAGGTGGAAGGG - Intronic
944041496 2:195360424-195360446 CTCAAGAAATGGAGTTGGAGGGG - Intergenic
944293801 2:198039193-198039215 CTCAAGAAGAGTAGTTGGCATGG + Intronic
944320293 2:198332547-198332569 CATAAGAAGGGGAGGTGGGATGG + Intronic
944426084 2:199584744-199584766 CTCATGAAGTGGAGATGGGAAGG - Intergenic
944524454 2:200604244-200604266 CTAAGGAAGAGGAGGAGGAATGG + Intronic
944797059 2:203198118-203198140 CTCAGGAGGCCGAGGTGGAAGGG - Intronic
944843643 2:203646906-203646928 CTCAGGGAGGGGAGCTGCAAGGG + Intergenic
946276740 2:218637205-218637227 GGCAAGAAGGGGAGGTACAAGGG + Intergenic
946467382 2:219924187-219924209 CTCACCAAGGGGATGTGGAAAGG + Intergenic
946735467 2:222750237-222750259 CTCAAGAGGCTGAGGTGGGAAGG - Intergenic
946842726 2:223834647-223834669 CTCAAGAAGCTGAGGTAGGAGGG + Intronic
947489040 2:230578195-230578217 CTCTGGAAGAGGAGGAGGAAGGG + Intergenic
948018933 2:234714488-234714510 GTCAAGAAGAAGGGGTGGAATGG - Intergenic
948193054 2:236074943-236074965 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
948978954 2:241482939-241482961 TTCGAGAATGGGAGGAGGAAAGG - Intronic
948978965 2:241483001-241483023 TTCGAGAATGGGAGGAGGAAAGG - Intronic
948978976 2:241483063-241483085 TTCGAGAATGGGAGGAGGAAAGG - Intronic
1169123243 20:3109861-3109883 CTCAGGCAGGGGGGGTGGCAGGG + Exonic
1169416073 20:5417238-5417260 CTCAGGAAGCTGAGGTGGGAGGG + Intergenic
1170066074 20:12311950-12311972 TTCAAGCAGGGAAGGTGGAGAGG - Intergenic
1170736471 20:19017594-19017616 CTCTAGGAGAGGAGGGGGAAGGG - Intergenic
1171001527 20:21421143-21421165 CTCAAGAGGCTGAGGTGGGATGG - Intergenic
1171397126 20:24842644-24842666 GATAAGAAGAGGAGGTGGAAGGG + Intergenic
1171541873 20:25965382-25965404 CTCAGGAAGCTGAGGTGGGAGGG - Intergenic
1171799179 20:29594931-29594953 CTCAGGAAGCTGAGGTGGGAGGG + Intergenic
1172451362 20:35026320-35026342 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1172779595 20:37428158-37428180 CTCAAGCAAATGAGGTGGAATGG - Intergenic
1173204551 20:40982581-40982603 CACAGGAAGGGCAGGTGGATGGG - Intergenic
1173376925 20:42493916-42493938 CTGAAGATGGGGAGGTTAAATGG - Intronic
1173445920 20:43118200-43118222 CACAAAAACAGGAGGTGGAATGG + Intronic
1173548735 20:43917307-43917329 CTCAAGAAGTGGATGGGGAGGGG + Intronic
1173807674 20:45936591-45936613 CTCAGGAGGCTGAGGTGGAAGGG - Intronic
1174025620 20:47571833-47571855 CTCAGGAGGCTGAGGTGGAAGGG - Intronic
1174312127 20:49665412-49665434 CTCAAAAAGGGGGGGTGGGGGGG + Intronic
1175674945 20:60938323-60938345 CCCAGGGAGGGGAGGTGCAAAGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1178968362 21:37146409-37146431 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
1179951289 21:44710128-44710150 CTCGAGCAGGGGAGGGAGAAAGG + Intronic
1180720791 22:17906833-17906855 CCCCAGAGGGGGAGGTGGGATGG + Exonic
1181755102 22:25018178-25018200 CTCTAGTAGGGGAGGAGGAAAGG - Intronic
1181832679 22:25574382-25574404 CTCAGGAAGCTGAGGTGGGAGGG + Intronic
1182026553 22:27123707-27123729 CTGAAGAAAGGGAGGCAGAAAGG + Intergenic
1182485002 22:30634298-30634320 CTCCAGAAAGGGTTGTGGAAAGG - Intergenic
1183412965 22:37666128-37666150 TTCAAGGAGGGGAGGTGACAGGG - Exonic
1183672224 22:39279811-39279833 CTCAAGAAACGGTGGGGGAACGG + Intergenic
1183675691 22:39297686-39297708 CCCAGGAAGGGGAGGGGGCAGGG - Intergenic
1184151636 22:42643131-42643153 TTCCAGAAGGGGAGGGGCAATGG - Intronic
1184786023 22:46672388-46672410 TTGAAGAAGGGCAGGTGGGAGGG + Intronic
1185382553 22:50516837-50516859 CACAAGTAGGGGACGGGGAAGGG - Intronic
950114361 3:10441085-10441107 CCCAGGAAAGGGAGGTGCAAAGG - Intronic
951651376 3:24955167-24955189 CAGCAGAAGGGGAGCTGGAAAGG + Intergenic
952080490 3:29752140-29752162 AGCAGGAAGGGGAGCTGGAAGGG + Intronic
952479771 3:33749123-33749145 CTCCAGAAAGGGATGGGGAAGGG + Intergenic
952585737 3:34890044-34890066 GTGAAGGAGGGGAGATGGAATGG - Intergenic
952768058 3:36972269-36972291 CTCAGGAAGCTGAGGTGGGAGGG + Intergenic
954239927 3:49285536-49285558 CTCAGGAGGGTGAGGTGGGAAGG + Intronic
954284102 3:49606670-49606692 TACAAAAGGGGGAGGTGGAAGGG - Intronic
954310098 3:49760008-49760030 CTCAGGAAGCTGAGGTGGGAAGG - Intronic
954646055 3:52132256-52132278 CTTCAGGAGGGGAGGAGGAATGG - Intronic
954654184 3:52183958-52183980 CACAAGAAGGGGAAGAGGGAGGG + Intergenic
955015251 3:55063801-55063823 CTCAAGAATGGGCCGTGGCAGGG + Intronic
956953255 3:74307151-74307173 CTCAAGAAGGAGAGCTGAATGGG + Intronic
957171573 3:76743974-76743996 CTCAAGCAAGGGAAATGGAAAGG + Intronic
958041260 3:88229689-88229711 GTCAGGAAGGGGAGGAGGAGAGG - Intergenic
958195963 3:90243279-90243301 CTGTAGAAGGGTATGTGGAATGG + Intergenic
958419150 3:93911913-93911935 CTGTAGAAGGGTATGTGGAATGG + Intronic
959695361 3:109244084-109244106 CTCAGAAGGGAGAGGTGGAAGGG - Intergenic
959763142 3:109992888-109992910 CTCAGGAGGTTGAGGTGGAAGGG - Intergenic
960959368 3:123058447-123058469 GTCAGGATGGGTAGGTGGAAAGG + Intergenic
962553079 3:136515287-136515309 CTCAGGAGGGGGAGGTTGCAGGG + Intronic
962594722 3:136929173-136929195 CTCAGGAAGCTGAGGTGGGAGGG - Intronic
963573507 3:147028466-147028488 CACAAGAAGGGGCTGTGGAAAGG - Intergenic
964211130 3:154229317-154229339 CTCAGGAGGCTGAGGTGGAAGGG - Intronic
966095522 3:176196550-176196572 ATCAGGATGGGGAGCTGGAAAGG + Intergenic
967042258 3:185704555-185704577 CTCAGGAAGCTGAGGTGGGAGGG - Intronic
967428455 3:189354570-189354592 CTCAGGAGGCTGAGGTGGAAGGG - Intergenic
967653347 3:192014495-192014517 CTCAGGAGGTGGAGGTGGGAGGG - Intergenic
967751882 3:193124491-193124513 CCCAAGAAGGAGAAATGGAAAGG + Intergenic
968026256 3:195444736-195444758 CTCATGAGGCTGAGGTGGAAGGG + Intergenic
968166143 3:196466826-196466848 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
970359244 4:15291786-15291808 CTTTAGAAGGGGAGGTGAAATGG - Intergenic
970415239 4:15850611-15850633 GTCAAGCAGGGGAGGAAGAAAGG - Exonic
972514645 4:39800466-39800488 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
973792945 4:54395039-54395061 CTCAAGCAGGGGAAGTGGCCTGG + Intergenic
974283877 4:59838435-59838457 CTCAAGATGGCCAGGTGGCAAGG - Intergenic
974344602 4:60662507-60662529 AGCAGGAAGGGGAGCTGGAAAGG + Intergenic
975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG + Intronic
977357848 4:95969329-95969351 AGCAGGAAGGGGAGCTGGAAAGG - Intergenic
978217723 4:106226054-106226076 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
978860964 4:113448621-113448643 CTCAGGAAGCTGAGGTAGAAAGG + Intergenic
979066251 4:116137652-116137674 CTGAGGAAGAGCAGGTGGAATGG - Intergenic
979267471 4:118720113-118720135 TTGAAGAAGGGGAGGCAGAATGG - Intergenic
979520933 4:121665774-121665796 CTGAAGGAGGGAAGGAGGAAAGG - Intergenic
980036967 4:127895819-127895841 CTCAAGAATCTGAGGTGGGAGGG + Intronic
980327561 4:131367987-131368009 CTCAGGAGGCTGAGGTGGAAGGG - Intergenic
981738486 4:147977808-147977830 CTCCAAAAGGGGAGGGGGAGGGG - Intronic
982546083 4:156734743-156734765 AGAAAGAAGGGGAGGAGGAATGG + Intergenic
982771576 4:159401572-159401594 CTCAAGAAGGGGTGGAGAGAAGG - Intergenic
984261736 4:177451213-177451235 CTCAGGAGGGTGAGGTGGAAGGG - Intergenic
984543812 4:181074443-181074465 AGCAGGAAGGGGAGCTGGAAAGG - Intergenic
984560399 4:181262009-181262031 CTAAACCAGGGCAGGTGGAAGGG - Intergenic
984700083 4:182813696-182813718 CTCAGGCAAGGGAGGTGGATGGG - Intergenic
984866454 4:184284328-184284350 CCCAAGAAGGGGAGGAGCAGGGG - Intergenic
985022917 4:185711075-185711097 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
985621361 5:957834-957856 CTCAAGAGGAGTGGGTGGAATGG - Intergenic
986721823 5:10565230-10565252 CTCCTGCAGGGGAGGAGGAATGG - Intronic
988799308 5:34681600-34681622 CTCAGGAGGTTGAGGTGGAAGGG - Intronic
989687812 5:44110073-44110095 CACCTGAAGGGGAGCTGGAAAGG - Intergenic
990298956 5:54431589-54431611 CTCAAGAGGCTGAGGTGGAAGGG + Intergenic
990390466 5:55314557-55314579 CTCTAGAAGTGGAAGTGGCAAGG + Intronic
990458023 5:56006628-56006650 CAAAAGAAGGGAAGGTGTAATGG - Intergenic
990599639 5:57344811-57344833 CTCAAGCAGGAGAAGAGGAAAGG - Intergenic
991365396 5:65862584-65862606 CTCAAGAATGAGAGGAGGGAGGG - Intronic
991501202 5:67279220-67279242 CTTAGGAATGGGAGGTGGCATGG - Intergenic
991551045 5:67836042-67836064 GACAAGAAGGGAAGGAGGAAGGG + Intergenic
993036250 5:82760795-82760817 AGCAGGAAGGGGAGCTGGAAAGG - Intergenic
993607185 5:90006205-90006227 CTCAGGAAGGAGTGGTGGGAAGG + Intergenic
993875344 5:93300021-93300043 CCAAAGAAGAGGAGGGGGAACGG + Intergenic
993896516 5:93541696-93541718 CTCAAGCAGGACAGGTGGAAAGG - Intergenic
995179840 5:109220776-109220798 CACATGAAGGGGAGGAGCAAGGG + Intergenic
995229540 5:109743582-109743604 CACAGGAAAGGGAGGTGGAAAGG - Intronic
995638154 5:114219431-114219453 CGCAGGAAGGGGAGCTGAAAAGG + Intergenic
995651817 5:114377996-114378018 CTCAAGGTGGGAAGGGGGAAAGG + Intronic
995759527 5:115548667-115548689 CTGAGGAATGGGATGTGGAATGG + Intergenic
996538182 5:124600737-124600759 CTCAGGAAGCTGAGGTGGGAGGG + Intergenic
996922998 5:128790660-128790682 CTCCAGCAGGGGATGTGAAATGG + Intronic
997107791 5:131041008-131041030 CTGGAGAAGGGGGTGTGGAATGG + Intergenic
997396557 5:133564646-133564668 TTCAAGAAAGAGAGTTGGAAAGG + Intronic
999346814 5:150830101-150830123 CTGAAGAAAGGGCGGAGGAAGGG + Intergenic
999471724 5:151860557-151860579 CTCAAGAAGTGAAGGAGGGATGG + Intronic
999879584 5:155846874-155846896 CTCATGAAGGAGAGGTTGAGAGG - Intergenic
1000233460 5:159336264-159336286 CACAGGAAGGGGAGGTGGAAAGG - Intergenic
1000298559 5:159934403-159934425 CTCAAGACGAGGGGGTGGGAAGG - Intronic
1000742514 5:164987236-164987258 GGCAAGATGGGGAGCTGGAAAGG - Intergenic
1001732279 5:173969270-173969292 GTCAAGAAGGGGAAATAGAAGGG - Intergenic
1002327633 5:178420386-178420408 CTCAGGGAGGGGAGGGGGAAAGG - Intronic
1002327719 5:178420611-178420633 CTCAGGGAGGGGAGGAGGAAAGG - Intronic
1003578696 6:7320081-7320103 CTCAAGAATGAGAGGAGGAAAGG - Intronic
1003681147 6:8258374-8258396 ATAAAGAAGGGGAGGAAGAAGGG + Intergenic
1003906962 6:10710298-10710320 CTCAAGAGGCGGAGGTGGGAAGG + Intergenic
1005268534 6:24138715-24138737 CTCAAGAGGGGGAACTGGAGAGG - Intronic
1005274010 6:24197262-24197284 CTCAGGAAGGGGAGTTGGGAGGG - Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006517137 6:34551342-34551364 CTCCAAAAGGGGATGTGGACTGG + Intronic
1006605592 6:35254615-35254637 CCCAGGAAGGGGAGGTTGCAGGG + Intergenic
1006649488 6:35539081-35539103 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
1006664192 6:35677889-35677911 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1007085079 6:39138169-39138191 CCCAAGAATGGGAGGTGGGAAGG - Intergenic
1007653443 6:43437591-43437613 CTCCAGAACGGGAGAGGGAAGGG - Intronic
1007674852 6:43585049-43585071 CTCAGGAAGCTGAGGTGGGAGGG + Intronic
1007688288 6:43680527-43680549 CCCAAGGAAGGGAGGTGGGATGG + Intronic
1007946770 6:45834052-45834074 CTCAGAAAAGGGAGGTGGGAAGG - Intergenic
1008078053 6:47166647-47166669 CTCAGGAAGGTGAGATGGGAGGG - Intergenic
1008349328 6:50471370-50471392 CTAAAGAAAGGGAAGAGGAAAGG + Intergenic
1008658803 6:53644330-53644352 CTGAAGATGGTGAGGTGTAATGG - Intergenic
1009856540 6:69272745-69272767 CTCAAGTAGGGTAGCTGTAAAGG + Intronic
1010308309 6:74350558-74350580 CTGAAGAAAGGGAGATGGAGAGG + Intergenic
1010385778 6:75277796-75277818 CTCAAGAGGCTGAGGTGGAAGGG + Intronic
1010869689 6:81022021-81022043 CTCAAAAATGGGAAGGGGAAGGG - Intergenic
1010951824 6:82045991-82046013 TTCAAATAGGGGAGATGGAAAGG - Intergenic
1011233817 6:85193038-85193060 AGCAGGAAGGGGAGCTGGAAAGG - Intergenic
1011345003 6:86359395-86359417 CAGAAGTAGGGGAGGTGAAAAGG + Intergenic
1011723175 6:90180526-90180548 CTCAAGAGGAGGAGGTTGAGAGG - Intronic
1013707627 6:112857279-112857301 CTCAAGGATGGGAGGTGAAAGGG - Intergenic
1014063686 6:117101572-117101594 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
1014742897 6:125167154-125167176 CTCAAGAGGCTGAGGTGGGAGGG + Intronic
1015802800 6:137077655-137077677 CTCAGGAGGCTGAGGTGGAAGGG + Intergenic
1015882355 6:137881727-137881749 CTGGGGGAGGGGAGGTGGAATGG - Exonic
1017488493 6:154923866-154923888 CTGAACAAAGGGAGGGGGAAGGG - Intronic
1017892977 6:158654551-158654573 TTCCTGAAGGGGAGATGGAAGGG + Intronic
1020287533 7:6696339-6696361 GTAAATAAAGGGAGGTGGAAAGG + Intronic
1021460333 7:20879777-20879799 CTCATGAACTGGAGGTGGCAGGG - Intergenic
1021561288 7:21971277-21971299 CTCGAGAAGCTGAGGTGGGAGGG - Intergenic
1023480547 7:40629121-40629143 CTCAAGAAGGAGCTTTGGAAAGG - Intronic
1023526174 7:41106268-41106290 CTGGAGAAGGGGCGGTGGGAGGG - Intergenic
1023734494 7:43222925-43222947 TTCAAGAAGGAGATGTGGGATGG - Intronic
1024642348 7:51340623-51340645 CACAAAAATGGGAGGTGCAAAGG + Intergenic
1025083421 7:56003827-56003849 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
1026134958 7:67651863-67651885 CTCAAGACGCTGAGGTGGGAGGG - Intergenic
1026181676 7:68046770-68046792 CTGGAGAAGGGGAGGAGGAAAGG + Intergenic
1026665081 7:72335196-72335218 GCCAAGAAGGAGAGCTGGAATGG + Intronic
1026910234 7:74087294-74087316 CTCAAGAGGCTGAGGTGGCAGGG + Intronic
1028192664 7:87870776-87870798 AGCAAGAAGGGGAGCTGAAAAGG - Intronic
1028449011 7:90959133-90959155 CACAAGAAGAGTAAGTGGAAAGG + Intronic
1028900990 7:96100408-96100430 CTCAAGAAGGAGAGAGGGAAAGG - Intronic
1029139096 7:98397293-98397315 CTTAAGAAGTGGAGGAAGAACGG - Intronic
1029409502 7:100399654-100399676 CTGGAGAAGGTGGGGTGGAAGGG + Intronic
1029428522 7:100513521-100513543 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
1029610754 7:101625380-101625402 TTCCAGACGGGGAGGTGGACGGG + Intronic
1031466147 7:122114743-122114765 TTCAAGAAGTGGAGGTGGGCTGG + Intronic
1031484532 7:122311298-122311320 CCAAAGAAGGGAAGGTAGAAAGG - Intergenic
1031998562 7:128249077-128249099 CCCAAGAAGGGGAGGAAGAATGG - Intronic
1032388756 7:131542168-131542190 CTCCAAAAGGGGTGGAGGAAAGG + Intronic
1032534717 7:132653145-132653167 CTCACAATGGTGAGGTGGAATGG + Intronic
1032676305 7:134132965-134132987 GTCAAGAAGGGGAGTTGAAAAGG + Intronic
1032952361 7:136929514-136929536 CAAAAGAAGGAGAGGTGAAAAGG - Intronic
1034027144 7:147717777-147717799 CTCAAGAGGCGGAGGTGGGAGGG + Intronic
1034055147 7:148026341-148026363 CTCAGGAGGCTGAGGTGGAAGGG + Intronic
1034531900 7:151701084-151701106 CTGAGGAGTGGGAGGTGGAAGGG - Intronic
1034604020 7:152293964-152293986 CTCAAGAGGTTGAGGTGGGAGGG - Intronic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035576295 8:708799-708821 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1035701004 8:1639266-1639288 CTCCAGAAGGAGCAGTGGAAAGG + Intronic
1036143422 8:6228757-6228779 CCGAAGACGTGGAGGTGGAAAGG - Intergenic
1036194696 8:6703852-6703874 CTCAAGGAGGGAAGGGGCAAAGG + Intergenic
1036251074 8:7163154-7163176 CTCAAGAAAGGAAGTTGTAATGG - Intergenic
1036366414 8:8124306-8124328 CTCAAGAAAGGAAGTTGTAATGG + Intergenic
1037313515 8:17579815-17579837 ATGAAGATGGGGAGCTGGAAAGG + Intronic
1037901042 8:22690041-22690063 CTCGAGAGGGGGAGGGGGTAAGG - Exonic
1038179218 8:25210868-25210890 CTGAATGAGGGGAGGGGGAAGGG + Intronic
1038458908 8:27699445-27699467 CTCATGAAGCTGAGGTGGGAGGG - Intergenic
1038471576 8:27827830-27827852 CATAAGAAGGGGAAGTGGCAGGG - Intronic
1039131808 8:34273390-34273412 ACCAAGAAGGGGAGGGGGGAGGG - Intergenic
1039981744 8:42414267-42414289 TTTAAGAAGGCGAGGTGGAGAGG + Intergenic
1041063809 8:54061672-54061694 CTCAGGAGGATGAGGTGGAAGGG + Intronic
1042413509 8:68492335-68492357 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1045003487 8:97898061-97898083 CTGAAGAAGGGAATGAGGAAGGG - Intronic
1045344461 8:101282005-101282027 ATCAAGAAGGGCAGGTGCAGTGG - Intergenic
1045392040 8:101725399-101725421 CACCAGAAGGGAAGCTGGAAAGG - Intronic
1045503226 8:102759041-102759063 CTCAAGGAGGGGAGGCCAAAGGG + Intergenic
1046744275 8:117860347-117860369 CTCAAGGTGGGAGGGTGGAAGGG + Intronic
1047307269 8:123662976-123662998 CTCTGGATGGGGAGGAGGAAAGG + Intergenic
1048962457 8:139591921-139591943 CTCAGGAAGGTGAGGTAGGAGGG + Intergenic
1049549239 8:143249168-143249190 CTCAGGAAGCTGAGGTGGGAAGG + Intronic
1049840796 8:144770225-144770247 CTCAGGAAGCTGAGATGGAAGGG + Intergenic
1050538207 9:6648147-6648169 CTCAAGATGGGGTGCTGGTAAGG - Intergenic
1050610478 9:7347213-7347235 CTAAGGAAGAGGAGGAGGAAAGG - Intergenic
1050815826 9:9810041-9810063 AGGAGGAAGGGGAGGTGGAAGGG - Intronic
1050829112 9:9989537-9989559 GGCAAGAAGGGGAGCTAGAAGGG - Intronic
1053072459 9:35109326-35109348 AACAAGAAGGGGAAGGGGAAGGG + Exonic
1053202204 9:36160383-36160405 CTCAGGAAGCTGAGGTGGGAGGG + Intronic
1053447892 9:38166991-38167013 TTGAAGAAGGGAAGGAGGAAGGG - Intergenic
1053583888 9:39436192-39436214 AGCAGGAAGGGGAGCTGGAAAGG + Intergenic
1054105469 9:60994936-60994958 AGCAGGAAGGGGAGCTGGAAAGG + Intergenic
1055376118 9:75649411-75649433 AGCAGGAAGGGGAGGTGAAAAGG + Intergenic
1055563483 9:77545211-77545233 CTTTAGAAGTGGAGGAGGAAAGG - Intronic
1055782231 9:79832409-79832431 CTCAGGAGGGTGAGGTGGGAGGG - Intergenic
1055998512 9:82189294-82189316 CTACAGAAGAGGAGGAGGAAAGG - Intergenic
1056943254 9:90973183-90973205 CTCGAGAGGGTGAGGTGGGAGGG - Intergenic
1057215429 9:93225286-93225308 CTCAAGAGGCTGAGGTGGGAGGG + Intronic
1057552092 9:96058971-96058993 TTCCAGAAGGGGAGGAGGCAAGG + Intergenic
1057762544 9:97888496-97888518 ATCATGAAGGGAAGCTGGAATGG + Intergenic
1058289733 9:103224268-103224290 CTCAATGAAGGGAGGTGAAATGG + Intergenic
1059024416 9:110610015-110610037 CTGCAGAAGAGCAGGTGGAATGG + Intergenic
1059353858 9:113684888-113684910 CTCAAGAGGGTGAAGTGGGAGGG - Intergenic
1059725454 9:117004225-117004247 CTCTAGAAGCTGAGGTGGGAGGG - Intronic
1059873688 9:118607537-118607559 TTAAAGAAGGGGAGAAGGAAAGG - Intergenic
1060324859 9:122604326-122604348 CCCAAGAAGGGGAATAGGAATGG + Intergenic
1060387144 9:123241399-123241421 CTCAAGAGGCTGAGGTGGGAGGG + Intronic
1060706149 9:125803193-125803215 CTCAGGAAGCTGAGGTGGGAGGG - Intronic
1060998018 9:127885943-127885965 CACTTGTAGGGGAGGTGGAAAGG + Exonic
1062169184 9:135125129-135125151 CTCAGGGGGGTGAGGTGGAAGGG + Intergenic
1186920280 X:14271021-14271043 ATCAAGAGAGTGAGGTGGAAGGG - Intergenic
1187389400 X:18875906-18875928 CTCCAGGAGGAGTGGTGGAAAGG + Intergenic
1187821791 X:23295714-23295736 CTCATGAAGGGTAGGGGGCAAGG + Intergenic
1188563486 X:31497453-31497475 ATAAAGAAGGGTAGGGGGAAAGG - Intronic
1189174733 X:38944728-38944750 GTCAGGAAGGGGAGGCTGAATGG - Intergenic
1189504298 X:41595495-41595517 CTCAAGATGGGGAGGTAGGAGGG + Intronic
1189993330 X:46614949-46614971 CTCTAGAGGAGGAGATGGAAGGG + Intronic
1192175026 X:68880047-68880069 CTCAAGAAGAGGCTGTGGAGTGG - Intergenic
1192409841 X:70924368-70924390 CTCAGGAGGCTGAGGTGGAAGGG - Intergenic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1195721287 X:107871658-107871680 AGCAGGAAGGGGAGCTGGAAAGG + Intronic
1196941966 X:120785882-120785904 CTGAAGAACAGGAGCTGGAAGGG - Intergenic
1197359370 X:125480397-125480419 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
1197899374 X:131353711-131353733 TTGAAGAAGGGGAGGTGGAACGG + Intronic
1199690053 X:150302680-150302702 CTCAAGAATGGGAGGCAGCAGGG - Intergenic
1199764505 X:150931083-150931105 CTCAGGAGGCTGAGGTGGAAGGG + Intergenic
1200246645 X:154530100-154530122 CTCCAGAAGGGGCTGTGGCAAGG - Intergenic
1201701189 Y:16883884-16883906 CAGCAGAAGGGGAGCTGGAAAGG + Intergenic