ID: 1145884160

View in Genome Browser
Species Human (GRCh38)
Location 17:28371358-28371380
Sequence CGATGTCACGTGGGGCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145884148_1145884160 22 Left 1145884148 17:28371313-28371335 CCATTTAGTAGGGAGGGGGCATC 0: 1
1: 0
2: 2
3: 5
4: 108
Right 1145884160 17:28371358-28371380 CGATGTCACGTGGGGCGGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 123
1145884150_1145884160 0 Left 1145884150 17:28371335-28371357 CCAGCGGTGTTGCTCCCACGTAC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1145884160 17:28371358-28371380 CGATGTCACGTGGGGCGGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145884160 Original CRISPR CGATGTCACGTGGGGCGGGG AGG Intronic
901749147 1:11395416-11395438 GGATGCCACGAGGGGAGGGGTGG + Intergenic
903839079 1:26225490-26225512 TGAACTCACTTGGGGCGGGGAGG + Intergenic
904039541 1:27575902-27575924 CGGGGTCACGTGGCGGGGGGAGG + Intronic
904354662 1:29931110-29931132 GGATGTCCCGAGGGGAGGGGAGG - Intergenic
907923502 1:58934583-58934605 AGAGGTCACCTGGGGCTGGGGGG + Intergenic
915316451 1:155031517-155031539 CGATGTGGGGTGGGGTGGGGTGG - Intronic
1064274630 10:13894406-13894428 CGATTTCTGGTGGGGCTGGGTGG - Intronic
1064832846 10:19490491-19490513 AGAAGCCAAGTGGGGCGGGGGGG + Intronic
1075999745 10:126905385-126905407 CGGCGTCATGTGGGACGGGGCGG - Intergenic
1076259097 10:129051378-129051400 CACTGTCACGTGGGGAGAGGTGG + Intergenic
1076981429 11:207024-207046 CGATCTCACAGGGGGCGGCGGGG + Intronic
1077351957 11:2097179-2097201 CGATGCCTCTTGGGGCCGGGTGG - Intergenic
1081872389 11:46389426-46389448 CGACGACAGCTGGGGCGGGGCGG - Intergenic
1083632244 11:64101812-64101834 CGATGTCCCGTGGGGCTTGCTGG + Intronic
1083858211 11:65404438-65404460 CGATGTCACCAGGGCAGGGGCGG - Intronic
1083908752 11:65692675-65692697 TGAGGTCAGGTGGTGCGGGGAGG + Intergenic
1084002243 11:66302704-66302726 CGATATCACGCGTGGTGGGGCGG - Intergenic
1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG + Intronic
1085507074 11:77066837-77066859 TGGTCTCCCGTGGGGCGGGGTGG - Intergenic
1086375378 11:86194962-86194984 CTATCTCAAGTGGGGAGGGGTGG - Intergenic
1087076133 11:94128793-94128815 CGCGGTGACGCGGGGCGGGGTGG - Intergenic
1090366598 11:126211715-126211737 GCAGGTCACGTGGTGCGGGGTGG + Exonic
1091885923 12:4016993-4017015 AGATGTCACCTGGGGCCTGGTGG + Intergenic
1094846961 12:34365509-34365531 CGTTCTCCCGTGGGGGGGGGGGG + Intergenic
1102646646 12:114408130-114408152 CGCTGTCACGTTTGGCTGGGGGG + Exonic
1105799275 13:23889412-23889434 GGCCGTCACGTGGGGCGGCGTGG - Exonic
1113566098 13:111320592-111320614 TGATGTCACAGCGGGCGGGGTGG + Intronic
1113877733 13:113605132-113605154 TGTTGTCAGTTGGGGCGGGGGGG + Intronic
1119455065 14:74748120-74748142 CAATGGCAGGTGGGGCGTGGTGG + Intergenic
1122030498 14:98908264-98908286 CGGAGGCAGGTGGGGCGGGGTGG - Intergenic
1122220860 14:100238660-100238682 CGATGGGACCGGGGGCGGGGCGG - Intronic
1123015205 14:105370298-105370320 GGCTGTCAGGTGGGGAGGGGGGG - Intronic
1124965324 15:34429082-34429104 AGATGTGACATGGGGTGGGGAGG - Intronic
1124981940 15:34575284-34575306 AGATGTGACATGGGGTGGGGAGG - Intronic
1129612863 15:77074246-77074268 CTATGCCACGTGGTGGGGGGTGG + Intronic
1132827979 16:1914370-1914392 CGAGGTCCCGTGGTGGGGGGTGG - Intronic
1133115588 16:3576374-3576396 CGAGGTCATGAGGGGCAGGGAGG - Intronic
1133982497 16:10643748-10643770 CAATTTCACGCCGGGCGGGGTGG + Intronic
1133991313 16:10709668-10709690 CAATATCACGGGGGGGGGGGGGG + Intergenic
1140865909 16:79062088-79062110 TGAGATCACGTGGGGTGGGGAGG - Intronic
1141063365 16:80895335-80895357 CAATGTCACTTGGGGGGTGGGGG - Intergenic
1141788815 16:86218987-86219009 TGATGTGAAGCGGGGCGGGGGGG + Intergenic
1141809449 16:86365182-86365204 TGATGTCACCTGGGGGTGGGTGG - Intergenic
1142509419 17:385027-385049 CGGTGTCGGGCGGGGCGGGGCGG + Intronic
1145884160 17:28371358-28371380 CGATGTCACGTGGGGCGGGGAGG + Intronic
1146763275 17:35496545-35496567 CGAGGTCATGAGGGGAGGGGAGG - Intronic
1149470855 17:56914087-56914109 GGAAGTCACGTGGGGTGCGGGGG + Intergenic
1151574351 17:74944266-74944288 TGATGCCACCCGGGGCGGGGTGG - Intronic
1152162618 17:78678330-78678352 CGATGCCACAGGGGGAGGGGCGG + Intronic
1152321484 17:79610660-79610682 CGAGGGCGCGTGGGGTGGGGTGG - Intergenic
1152410432 17:80120266-80120288 GGAGGTGACGTGGGGAGGGGAGG - Intergenic
1152932376 17:83116382-83116404 CGAGGCCTCGTGGGGCCGGGCGG + Intergenic
1153457063 18:5294574-5294596 CAATGGCAAGGGGGGCGGGGCGG - Intronic
1160690841 19:460310-460332 CGGCGTCACGTGGGGAGGGGCGG - Intronic
1160915449 19:1494323-1494345 CAGTGTCCCCTGGGGCGGGGTGG - Intronic
1161319145 19:3633042-3633064 CGAGGTCCGGTGGGGCGGCGAGG + Exonic
1167018881 19:46860278-46860300 CGACGTAACGTGGGGCGGTGGGG - Intergenic
1167437395 19:49487376-49487398 AGAGATCACGTGGGGCGCGGAGG - Intergenic
1167569825 19:50280189-50280211 CAATGTCAGGTGTGGCTGGGAGG - Intronic
1167736730 19:51299162-51299184 GGATGGGACGTGGCGCGGGGGGG - Intergenic
1168341229 19:55624289-55624311 CTATGTCATGGTGGGCGGGGTGG - Intronic
927514419 2:23663429-23663451 CGCCGTCACGTGTGCCGGGGAGG + Intronic
930111529 2:47682859-47682881 AGATGTCACCTGGGGAGTGGTGG + Intergenic
935360919 2:102245660-102245682 CGCTGGCCCGTGGGGAGGGGTGG + Intergenic
944612109 2:201421553-201421575 AGATGTCCCCTGGGGTGGGGGGG + Intronic
944652406 2:201844298-201844320 CGAAGTCATGGGGGGCAGGGTGG + Intronic
948596876 2:239085178-239085200 CCATGTCTCCTGGGGCGTGGCGG - Intronic
1169800244 20:9506680-9506702 AGATGCCACGTGGCGCGGTGCGG + Intergenic
1170596192 20:17807303-17807325 CACAGTCACCTGGGGCGGGGAGG + Intergenic
1174976747 20:55344427-55344449 CGCTTTCTCCTGGGGCGGGGGGG + Intergenic
1175358646 20:58389625-58389647 CGCTGTCGCGGGGGGCGGCGAGG + Intronic
1175562279 20:59940340-59940362 CGGCGTCACGAGGGGCGGGGCGG - Intronic
1176146997 20:63569872-63569894 GGATGTCCCGTGGGGCAGTGTGG + Intronic
1176232129 20:64038064-64038086 CGCCGTGAAGTGGGGCGGGGCGG + Intronic
1176550095 21:8217211-8217233 CGACGAGACGTGGGGTGGGGGGG - Intergenic
1176569023 21:8400246-8400268 CGACGAGACGTGGGGTGGGGGGG - Intergenic
1176576937 21:8444481-8444503 CGACGAGACGTGGGGTGGGGGGG - Intergenic
1181006685 22:20016853-20016875 TGCTGTCAGATGGGGCGGGGCGG - Intergenic
1183116121 22:35694018-35694040 CAATATCACATGGGGGGGGGTGG - Intergenic
1184481886 22:44752762-44752784 CGACGCCACGTGCGGCCGGGGGG + Intronic
951558762 3:23945685-23945707 CCATGGCCGGTGGGGCGGGGTGG + Intronic
953759301 3:45674261-45674283 TGATGTACCGTGGGGTGGGGAGG - Intronic
955948462 3:64218184-64218206 TGTTGTCACCTGGGGTGGGGAGG - Intronic
961820956 3:129575437-129575459 CGAGGCCATGTGGGGCGGGTGGG + Intronic
964147810 3:153487023-153487045 CCATGTCAGGTTGGGCGCGGTGG + Intronic
964889123 3:161516846-161516868 CAATATCACGGGGGGGGGGGGGG + Intergenic
964889635 3:161519660-161519682 CAATATTACGGGGGGCGGGGTGG + Intergenic
967093782 3:186159839-186159861 TGAGGTCACAAGGGGCGGGGGGG + Intronic
969392889 4:6902518-6902540 GGACCTCACGTGTGGCGGGGCGG + Intergenic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
978543275 4:109842114-109842136 TGATGTGAAGTGGGGTGGGGTGG + Intronic
984155886 4:176195623-176195645 CGCGGTCTCGTGGGGCGGGGCGG + Exonic
985781112 5:1872342-1872364 CCAGGCCACGGGGGGCGGGGGGG - Intergenic
986288952 5:6383440-6383462 CCATGTCACATGGGCTGGGGTGG + Intergenic
994396926 5:99232963-99232985 CCATATCACGTGGGGGGTGGAGG + Intergenic
996405438 5:123098828-123098850 CGGGGACAGGTGGGGCGGGGTGG - Intronic
996594615 5:125185998-125186020 CCATGTTAGGTGGGGGGGGGGGG + Intergenic
997584094 5:135034447-135034469 CGAGGCCGCGGGGGGCGGGGAGG - Intronic
999325579 5:150641432-150641454 CAGGGTCAGGTGGGGCGGGGTGG - Intronic
1002051948 5:176576254-176576276 CGGTGTCATGTGGTGCTGGGTGG + Intronic
1009999519 6:70934362-70934384 TGATGTGAAGTGGGGTGGGGCGG - Intronic
1014802241 6:125790565-125790587 GGAGGTCGCGGGGGGCGGGGAGG + Intronic
1019336621 7:485865-485887 CAATGCCAGGTGGGGCAGGGAGG + Intergenic
1019402940 7:866716-866738 CGGTGGGACGGGGGGCGGGGGGG - Intronic
1022485281 7:30772983-30773005 CCATGTCAAGTGGGGGGTGGTGG - Intronic
1023811644 7:43916712-43916734 CCATGTTATGTGGGGGGGGGGGG - Intronic
1029459597 7:100687284-100687306 GGATGACAGGTGGGGCGGGGAGG - Exonic
1029736527 7:102468570-102468592 CGTGGCCACGTGCGGCGGGGAGG + Exonic
1032263931 7:130357272-130357294 CTGTGGCAGGTGGGGCGGGGAGG + Intronic
1036604449 8:10293370-10293392 AGATGACTTGTGGGGCGGGGAGG - Intronic
1036733304 8:11284776-11284798 GGCTGGCCCGTGGGGCGGGGCGG - Exonic
1038444959 8:27596816-27596838 CTCTGTCTCGGGGGGCGGGGGGG + Intergenic
1038786150 8:30618276-30618298 CTCTGTCTCGGGGGGCGGGGGGG + Intronic
1042049831 8:64691472-64691494 CGATGGCAACTGGGGGGGGGGGG + Intronic
1045750446 8:105477528-105477550 TGATATCATGTGGGGCGCGGTGG - Intronic
1047454655 8:124998257-124998279 CGATGTTGCGTGGTGCGGGTTGG - Intergenic
1049260293 8:141635388-141635410 CCCTATCACGTGGTGCGGGGTGG + Intergenic
1050080610 9:1912025-1912047 GGATGTCACGTGGGCCTTGGAGG + Intergenic
1060087153 9:120713782-120713804 CGGTGGCAGGTGGGGTGGGGAGG + Exonic
1060823106 9:126672705-126672727 AGATGTCACATGGGGTGCGGGGG + Intronic
1061295337 9:129673956-129673978 GGAGGTGACGTGGGGCAGGGGGG + Intronic
1061625625 9:131839130-131839152 TGATCTCAGGTGGGGCTGGGGGG + Intergenic
1203471388 Un_GL000220v1:116683-116705 CGACGAGACGTGGGGTGGGGGGG - Intergenic
1203479209 Un_GL000220v1:160655-160677 CGACGAGACGTGGGGTGGGGGGG - Intergenic
1192467865 X:71370351-71370373 CTCTGTCAGGTGGGGTGGGGTGG - Intronic
1195212054 X:102659899-102659921 CGCAGTCACGTGGAGGGGGGAGG + Intergenic
1195510059 X:105705157-105705179 CCATGTCATTTGGGGTGGGGGGG + Intronic
1198737844 X:139807191-139807213 CAAGGGAACGTGGGGCGGGGAGG + Intronic
1199857060 X:151768028-151768050 GGAAGTTACGTGGGGTGGGGGGG + Intergenic