ID: 1145886303

View in Genome Browser
Species Human (GRCh38)
Location 17:28384654-28384676
Sequence CAAAAGCGACCCTGGCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145886303_1145886314 11 Left 1145886303 17:28384654-28384676 CCGCGGCGCCAGGGTCGCTTTTG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1145886314 17:28384688-28384710 CCTGTACGCAGCCACCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1145886303_1145886315 19 Left 1145886303 17:28384654-28384676 CCGCGGCGCCAGGGTCGCTTTTG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1145886315 17:28384696-28384718 CAGCCACCGTTAGGGTCACTCGG 0: 1
1: 0
2: 0
3: 4
4: 66
1145886303_1145886312 10 Left 1145886303 17:28384654-28384676 CCGCGGCGCCAGGGTCGCTTTTG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1145886312 17:28384687-28384709 GCCTGTACGCAGCCACCGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145886303 Original CRISPR CAAAAGCGACCCTGGCGCCG CGG (reversed) Intronic
901701299 1:11045995-11046017 CAAAAACGACGCAGGGGCCGAGG - Intronic
904004697 1:27357616-27357638 CAAAAGAGACGCTGCCGCGGAGG + Intronic
905409981 1:37761897-37761919 CAGCAGCATCCCTGGCGCCGCGG - Exonic
908124138 1:61013471-61013493 CCAAAGTGACCCTGGCTCAGAGG + Intronic
911856960 1:102890459-102890481 CAAAGGTGACCCTGGCTCCAAGG - Exonic
912505020 1:110150476-110150498 GAAAGGCCACCCTGGCGGCGGGG - Exonic
912682685 1:111739162-111739184 TAAGAGCGAAGCTGGCGCCGGGG - Intronic
915520144 1:156437097-156437119 CAGAAGCGGCCCTGGATCCGGGG - Intergenic
920697141 1:208189518-208189540 AAAAAGCGAACCTGGGGCTGAGG + Intronic
1065020457 10:21497475-21497497 CAGAGGCGTCCCTGGCGCCTTGG - Intergenic
1065778997 10:29149372-29149394 CAAAAGCTAGCCTGGCGTGGTGG - Intergenic
1076682822 10:132183167-132183189 TAAAAGCTACCGTGGCGCTGTGG + Exonic
1080367825 11:31597722-31597744 CAAAAGCTAGCCTGGCGTGGTGG - Intronic
1083720091 11:64599664-64599686 CAAAGGCGAACCTGGGGCAGGGG - Exonic
1084195830 11:67523292-67523314 GCCAAGCGGCCCTGGCGCCGGGG - Exonic
1084542650 11:69797185-69797207 AAAGAGCCAGCCTGGCGCCGTGG - Intergenic
1093925581 12:24905098-24905120 CAAAAGAGAGCCTGGGGCTGCGG + Intronic
1103357899 12:120335319-120335341 GACAAGCCACCCAGGCGCCGAGG + Intergenic
1109977690 13:69861660-69861682 TAAAAGCAAGCCTGGCGCAGTGG + Intronic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1121602320 14:95214583-95214605 CTCAAGCGACCCTGCCGCCATGG + Intronic
1122988940 14:105227509-105227531 CAGAAGGGACCTGGGCGCCGAGG - Intronic
1124345303 15:28918215-28918237 CAGAAGCGTTCCTGGCGCCACGG + Intronic
1129696681 15:77744244-77744266 CAAAAGCCAGCCTGGCACAGTGG + Intronic
1129906446 15:79190991-79191013 CAACTGTGACCCTGGGGCCGAGG - Intergenic
1130884278 15:88080593-88080615 CAAAAGCCACCCTGGGCCTGAGG + Intronic
1131485924 15:92820528-92820550 CAAAAGGGCCCTGGGCGCCGGGG - Intergenic
1132309068 15:100843206-100843228 CAAATCCAACCCTGGCGCTGTGG - Intergenic
1132841156 16:1979095-1979117 CGAGGGCGGCCCTGGCGCCGTGG + Exonic
1132879629 16:2156238-2156260 AAAAAGCGACCCGGGCCGCGTGG - Intronic
1136352784 16:29722064-29722086 GACAAGCCACCCAGGCGCCGAGG - Intergenic
1140354998 16:74297665-74297687 TAAATACGACCCTGGGGCCGGGG - Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1148371396 17:47102331-47102353 CAAAAGTTAGCCTGGCGCAGTGG - Intergenic
1149752981 17:59163910-59163932 CAAAACTTAGCCTGGCGCCGTGG + Intronic
1149840513 17:59960658-59960680 CAAAAGTTAGCCAGGCGCCGTGG + Intronic
1154173827 18:12068592-12068614 AAAAAGCCACCCTGCGGCCGGGG - Intergenic
1162216319 19:9136990-9137012 AAAAAACGTGCCTGGCGCCGTGG + Intergenic
1162225861 19:9221636-9221658 CAAAAGACAGCCTGGCGCGGTGG - Intergenic
1163113625 19:15176608-15176630 CAAAAGTTACCCGGGCGCGGTGG + Intronic
1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG + Exonic
1168660308 19:58160498-58160520 CAAAAACGGGCCAGGCGCCGTGG + Intergenic
933680481 2:85095487-85095509 CAAAAGCGACCCTCCCGCCTTGG + Intergenic
939126447 2:138183291-138183313 AAAAAGCTACCCTGGCTCAGAGG + Intergenic
940414923 2:153408527-153408549 CAAAAGGGACCCTGGCTCACTGG + Intergenic
948190095 2:236051687-236051709 TAAAAGCGACCCTGGGGGCAGGG + Intronic
1169382739 20:5122267-5122289 CAAAATAGACCCGGGCGCGGTGG - Intronic
1173021352 20:39270116-39270138 CAAAAGAGAGCCTGGCACAGAGG - Intergenic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1183922118 22:41177682-41177704 CAACAGCCACCCTGGAGCCAAGG + Exonic
950538303 3:13594615-13594637 CTAAAGTGATCCTGGCTCCGTGG + Intronic
953223599 3:40997285-40997307 CAAAAGCGTCCCTGATGCTGGGG - Intergenic
958925272 3:100150224-100150246 CAAAAGAAACCCTGGCCCCAAGG - Intronic
961351743 3:126308535-126308557 CAAGTGCGACCCTGGCGCTCGGG + Intergenic
961689348 3:128657415-128657437 AAAAAACGAGCCGGGCGCCGTGG + Intronic
968742240 4:2337165-2337187 GAAAAGCGACCGTGGGGCGGTGG + Intronic
980442301 4:132865188-132865210 CAAAAGCTGGCCTGGCGCAGTGG - Intergenic
985665171 5:1178377-1178399 CAAAAGCCACCCAGACACCGAGG + Intergenic
989450015 5:41575511-41575533 CAAATGCTACCCTGGCCCCCTGG + Intergenic
997400994 5:133602234-133602256 CAAAAGCTACCCTGGAGCAGGGG + Intronic
998418924 5:141965991-141966013 AAAAAGTGGCCCAGGCGCCGTGG + Intronic
1003065963 6:2903550-2903572 CTGAAGAGGCCCTGGCGCCGGGG - Intergenic
1003086221 6:3063678-3063700 CTGAAGAGGCCCTGGCGCCGGGG + Intergenic
1012476369 6:99618770-99618792 CAATAGCAACCCTGGCTCCAAGG - Intergenic
1013294949 6:108750849-108750871 GAAAAGGGACTCTGGCGCCAAGG - Intergenic
1015880511 6:137866796-137866818 TAAAAACCACCCTGGCGCCCGGG - Intergenic
1023842521 7:44105114-44105136 CAAAAGCGGCCCTGCCGCCCGGG - Intronic
1030018091 7:105244616-105244638 CAAAGGCGGCCCTGGCGCGCTGG - Intronic
1032716507 7:134513406-134513428 CAAAATCAAGCCTGGGGCCGCGG - Intergenic
1034584516 7:152077338-152077360 CAAAAGCGGCCCTGGGTCAGAGG - Intronic
1050532292 9:6601018-6601040 CAAAAACTAGCCTGGCGCTGTGG + Intronic
1057304832 9:93905968-93905990 CAGAAGGGACGCTGGCGTCGGGG - Intergenic
1203770514 EBV:47746-47768 GAAAAGCGAGCCTGGCGTAGAGG - Intergenic
1187169210 X:16834937-16834959 CACAAGCGATCCTGCCGCCTCGG - Intronic