ID: 1145886312

View in Genome Browser
Species Human (GRCh38)
Location 17:28384687-28384709
Sequence GCCTGTACGCAGCCACCGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145886302_1145886312 11 Left 1145886302 17:28384653-28384675 CCCGCGGCGCCAGGGTCGCTTTT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1145886312 17:28384687-28384709 GCCTGTACGCAGCCACCGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 24
1145886293_1145886312 29 Left 1145886293 17:28384635-28384657 CCCTCCCCGCCTCGCAATCCCGC 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1145886312 17:28384687-28384709 GCCTGTACGCAGCCACCGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 24
1145886296_1145886312 25 Left 1145886296 17:28384639-28384661 CCCCGCCTCGCAATCCCGCGGCG 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1145886312 17:28384687-28384709 GCCTGTACGCAGCCACCGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 24
1145886298_1145886312 23 Left 1145886298 17:28384641-28384663 CCGCCTCGCAATCCCGCGGCGCC 0: 1
1: 0
2: 1
3: 8
4: 84
Right 1145886312 17:28384687-28384709 GCCTGTACGCAGCCACCGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 24
1145886294_1145886312 28 Left 1145886294 17:28384636-28384658 CCTCCCCGCCTCGCAATCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1145886312 17:28384687-28384709 GCCTGTACGCAGCCACCGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 24
1145886309_1145886312 2 Left 1145886309 17:28384662-28384684 CCAGGGTCGCTTTTGGGGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1145886312 17:28384687-28384709 GCCTGTACGCAGCCACCGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 24
1145886303_1145886312 10 Left 1145886303 17:28384654-28384676 CCGCGGCGCCAGGGTCGCTTTTG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1145886312 17:28384687-28384709 GCCTGTACGCAGCCACCGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 24
1145886299_1145886312 20 Left 1145886299 17:28384644-28384666 CCTCGCAATCCCGCGGCGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 51
Right 1145886312 17:28384687-28384709 GCCTGTACGCAGCCACCGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 24
1145886297_1145886312 24 Left 1145886297 17:28384640-28384662 CCCGCCTCGCAATCCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 83
Right 1145886312 17:28384687-28384709 GCCTGTACGCAGCCACCGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145886312 Original CRISPR GCCTGTACGCAGCCACCGTT AGG Intronic
905140655 1:35841284-35841306 GCCGGTACTGTGCCACCGTTCGG + Exonic
907102677 1:51851028-51851050 CCCTGGCCGCAGCCACCCTTGGG + Intronic
911094348 1:94043453-94043475 GCATGTGCTCAGCCACCGTGAGG + Exonic
912383971 1:109262275-109262297 TCCTGTCCACAGCCACTGTTGGG + Exonic
919886969 1:201941835-201941857 GCCTGTACCCAGCCAGGGTCAGG - Intronic
919970808 1:202576548-202576570 GGCTGTAAGCAGCCACTGTTAGG + Intronic
1074818971 10:117165296-117165318 GCCTGGACACAGCCTCCTTTAGG + Intergenic
1084486489 11:69451161-69451183 GGCTGTATGCAGCCAGCCTTTGG - Intergenic
1093128283 12:15356987-15357009 CCCTGCACGCAGCCACTGTGGGG + Intronic
1114280922 14:21192093-21192115 CCCGGTCTGCAGCCACCGTTTGG - Intergenic
1139640559 16:68288569-68288591 GACTGTACACAGCCACATTTAGG - Intronic
1141159228 16:81617989-81618011 GCCTGTAAGCTGCCACCGGCTGG - Intronic
1145886312 17:28384687-28384709 GCCTGTACGCAGCCACCGTTAGG + Intronic
1152567627 17:81107239-81107261 GCCTGGACGCCGCCGCCTTTTGG + Intronic
1167717547 19:51153748-51153770 ACCTGAACGCAGCCCCCGTGAGG - Intergenic
937289357 2:120772833-120772855 TCCAGCATGCAGCCACCGTTAGG + Intronic
945836865 2:214844329-214844351 GCCTGAACTCAGCCATCATTTGG + Intergenic
1173024816 20:39298189-39298211 GCCTGTAGCCAGCCCCCATTTGG + Intergenic
1175206733 20:57317136-57317158 GCCTGCACTCAGACACAGTTTGG - Intergenic
1182765227 22:32753501-32753523 GCCTACACCCAGCCACCGCTGGG + Intronic
984238808 4:177193382-177193404 GCCTGTAGGCTGGCACTGTTGGG + Intergenic
998586378 5:143431748-143431770 GCCTGTACACAGCCACCCTAGGG + Intronic
1029224144 7:99012869-99012891 GGCTGTACACAGCCAGCCTTGGG + Exonic
1032268720 7:130385376-130385398 GCCTGTCCGAAGCCACCTTGGGG - Intronic
1035087283 7:156271398-156271420 CCCTGTACTCAGCCACACTTGGG - Intergenic
1040316294 8:46262663-46262685 GCCTGGCCGCAGCAACTGTTGGG + Intergenic
1062562498 9:137147866-137147888 CCCTGTCCGCGTCCACCGTTCGG - Intronic