ID: 1145886314

View in Genome Browser
Species Human (GRCh38)
Location 17:28384688-28384710
Sequence CCTGTACGCAGCCACCGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145886296_1145886314 26 Left 1145886296 17:28384639-28384661 CCCCGCCTCGCAATCCCGCGGCG 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1145886314 17:28384688-28384710 CCTGTACGCAGCCACCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1145886293_1145886314 30 Left 1145886293 17:28384635-28384657 CCCTCCCCGCCTCGCAATCCCGC 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1145886314 17:28384688-28384710 CCTGTACGCAGCCACCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1145886309_1145886314 3 Left 1145886309 17:28384662-28384684 CCAGGGTCGCTTTTGGGGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1145886314 17:28384688-28384710 CCTGTACGCAGCCACCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1145886302_1145886314 12 Left 1145886302 17:28384653-28384675 CCCGCGGCGCCAGGGTCGCTTTT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1145886314 17:28384688-28384710 CCTGTACGCAGCCACCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1145886294_1145886314 29 Left 1145886294 17:28384636-28384658 CCTCCCCGCCTCGCAATCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1145886314 17:28384688-28384710 CCTGTACGCAGCCACCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1145886297_1145886314 25 Left 1145886297 17:28384640-28384662 CCCGCCTCGCAATCCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 83
Right 1145886314 17:28384688-28384710 CCTGTACGCAGCCACCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1145886299_1145886314 21 Left 1145886299 17:28384644-28384666 CCTCGCAATCCCGCGGCGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 51
Right 1145886314 17:28384688-28384710 CCTGTACGCAGCCACCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1145886303_1145886314 11 Left 1145886303 17:28384654-28384676 CCGCGGCGCCAGGGTCGCTTTTG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1145886314 17:28384688-28384710 CCTGTACGCAGCCACCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1145886298_1145886314 24 Left 1145886298 17:28384641-28384663 CCGCCTCGCAATCCCGCGGCGCC 0: 1
1: 0
2: 1
3: 8
4: 84
Right 1145886314 17:28384688-28384710 CCTGTACGCAGCCACCGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145886314 Original CRISPR CCTGTACGCAGCCACCGTTA GGG Intronic
900940551 1:5795907-5795929 CCAGTACTCAGTCACCGCTAGGG + Intergenic
902629113 1:17694395-17694417 CCTGTTCTCAGCCACCGTGCTGG + Intronic
914825926 1:151138076-151138098 CCTGTACTCAGCCACAGCTGCGG - Exonic
919886967 1:201941834-201941856 CCTGTACCCAGCCAGGGTCAGGG - Intronic
1074873308 10:117594832-117594854 CCTGTTCGCAGCCACCCGTCAGG - Intergenic
1080282999 11:30580317-30580339 GCTGTACTCATCCACCGTTATGG + Exonic
1093128285 12:15356988-15357010 CCTGCACGCAGCCACTGTGGGGG + Intronic
1104409617 12:128547250-128547272 CCTGCAAGCAGCCACAGTCATGG - Intronic
1114280920 14:21192092-21192114 CCGGTCTGCAGCCACCGTTTGGG - Intergenic
1128127560 15:65204286-65204308 CCTGAAGGCAGCCACCATCAAGG - Exonic
1139640558 16:68288568-68288590 ACTGTACACAGCCACATTTAGGG - Intronic
1142638600 17:1272125-1272147 CCTGGAAGCAGCCACAGTGAAGG + Intergenic
1145886314 17:28384688-28384710 CCTGTACGCAGCCACCGTTAGGG + Intronic
1146640999 17:34541436-34541458 CCTGTAAGCAGCCACCCCAAGGG - Intergenic
1160617241 18:80140603-80140625 CCTGAACACAGCCACAGTGAAGG - Intronic
1169890954 20:10451501-10451523 CTTGTAGGTAGCCACCATTATGG - Intronic
1172771848 20:37386646-37386668 CCTGATCGCAGCCTGCGTTAAGG - Intronic
1175064498 20:56273447-56273469 CCTGTCCCCAGCCACCGATTAGG + Intergenic
1175163314 20:57024679-57024701 CCTGTGTGCAGCCACAGTGAAGG - Intergenic
1176025409 20:62982988-62983010 CCTCTTCGCAGCCACCTTTAAGG - Intergenic
1177265238 21:18774889-18774911 CCTGGACTCAGCCACACTTAGGG + Intergenic
952888022 3:38023602-38023624 ACTTTACGCAGCCACTGTGAAGG + Intronic
960561885 3:119093484-119093506 CCTGTACCCAGCCACATTTTAGG + Intronic
975221726 4:71820359-71820381 CCTGTACCCAGCCATAGTGAAGG - Intergenic
998586380 5:143431749-143431771 CCTGTACACAGCCACCCTAGGGG + Intronic
1000096217 5:157973158-157973180 CCTGTAGGTAGCCACTGATATGG - Intergenic
1030538651 7:110801742-110801764 CCTGTACACAGGCACTGGTAAGG + Intronic
1035087281 7:156271397-156271419 CCTGTACTCAGCCACACTTGGGG - Intergenic
1049316770 8:141973465-141973487 CGTGAACGCAGGCACCGTGAGGG - Intergenic