ID: 1145887159

View in Genome Browser
Species Human (GRCh38)
Location 17:28390292-28390314
Sequence TTGTGCAGAGGAAGTTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145887159 Original CRISPR TTGTGCAGAGGAAGTTCTCA GGG Intronic
905890503 1:41515926-41515948 TTTTGCAGATGAAGGTCACAGGG + Intronic
913210963 1:116581961-116581983 ATGTGCAGTGGAACTTATCATGG + Intronic
913316995 1:117561898-117561920 TTGAGCAGAGAAAGTTCTGTTGG + Intergenic
913447587 1:118966314-118966336 TCGTGCAGAGCAGGTTCTCCTGG + Intronic
913532246 1:119741531-119741553 TTTTGGAGAGGAGTTTCTCAGGG + Intronic
913611520 1:120514005-120514027 TAGGGCAGAGGAAGTCATCATGG - Intergenic
914579672 1:149008234-149008256 TAGGGCAGAGGAAGTCATCATGG + Intronic
915296628 1:154925991-154926013 TAGTGGAGAGGAAGTTCTGCTGG - Intronic
919949548 1:202349745-202349767 TTCTCCATAGGAAGCTCTCAGGG - Intronic
922227779 1:223660504-223660526 TTGCCCAGAGGAAGGGCTCAAGG - Intronic
922494162 1:226042912-226042934 GTGGCCAGAGGAAGTTCTGATGG + Intergenic
922558670 1:226551259-226551281 TGGTGCATAGGAAGCTCTCTGGG + Intronic
923021282 1:230166074-230166096 TTGTGCAGAGGACACTGTCATGG - Intronic
923368717 1:233289039-233289061 TTGTGAAGACCAAGTCCTCAAGG + Intronic
1063270532 10:4505494-4505516 TTGTGCAGAGGAACGTCTGTGGG + Intergenic
1063900053 10:10723359-10723381 TCCTGGAGAGGAAATTCTCAGGG + Intergenic
1064026203 10:11850715-11850737 TGTTTCAGAGGAAGTTTTCATGG + Intronic
1064900401 10:20289732-20289754 TTGTACAGAGCCAGTGCTCAGGG - Exonic
1065554183 10:26897852-26897874 TTCAGCAGAGGCAGATCTCAGGG - Intergenic
1065599142 10:27350755-27350777 TTCAGCAGAGGCAGATCTCAGGG + Intergenic
1066112553 10:32210301-32210323 TTGTGCAGAGGAAGTCTTCCGGG - Intergenic
1066194021 10:33081301-33081323 TTGTTCAGATAGAGTTCTCATGG + Intergenic
1067319410 10:45204051-45204073 TTCAGCAGAGGCAGATCTCAGGG + Intergenic
1067536483 10:47114304-47114326 TTGTACAGAGAAAGCTATCAGGG + Intergenic
1068642997 10:59432202-59432224 TTGTGCAGAGGAAGGGAGCAAGG + Intergenic
1069313602 10:67070020-67070042 TAGAGCAATGGAAGTTCTCATGG - Intronic
1070684623 10:78471594-78471616 TTGTGCAGAGGATGGTGGCATGG + Intergenic
1070849577 10:79552606-79552628 TTGGGCAGAGGAGCTTCTCATGG - Intergenic
1073830610 10:107379012-107379034 TTAGGTAGAGGAAGTTCTAATGG + Intergenic
1076496774 10:130902681-130902703 TTGTGCCGTGGGAGTTCACAGGG - Intergenic
1077297235 11:1831952-1831974 TTTTCCAGAGGAAGGGCTCACGG + Intronic
1077708347 11:4510736-4510758 TTCTGCAGAGGCATTTCTCAGGG + Intergenic
1079544150 11:21612459-21612481 TTGTGCAGAGGGAGATTTCAGGG + Intergenic
1079560690 11:21815105-21815127 TTGTGCAGAGAAAGCCCTCCAGG + Intergenic
1080040744 11:27757002-27757024 TAGTGCAGGTAAAGTTCTCATGG + Intergenic
1080987780 11:37491481-37491503 TTGTTTTGAGAAAGTTCTCAAGG + Intergenic
1083200692 11:61119355-61119377 TGTTGCAGAGGAAGTTCTCCAGG - Exonic
1084118917 11:67057524-67057546 CTGTGCACAGGAAGGACTCACGG + Intronic
1084543079 11:69799285-69799307 TTGGGCTGGGGAAGCTCTCATGG + Intergenic
1085643633 11:78208871-78208893 ATGCGGAGAGGAAGTTCTCTGGG - Exonic
1086172033 11:83847605-83847627 TTGTTCAGAGGCTGTTTTCAAGG - Intronic
1088511354 11:110579062-110579084 TTCTGCAGAGGAAGCACTTATGG - Exonic
1089492722 11:118893892-118893914 TTTTGCAGAGGAAGGTCCCCAGG - Exonic
1092051229 12:5471968-5471990 GTGTGCAGAGGAAGGTCTTGGGG - Intronic
1098817163 12:75182156-75182178 TCATGCAGAGGCAGTTGTCATGG - Intronic
1098862447 12:75725116-75725138 TTGTGCAGAGCCAGTTTTGAAGG + Intergenic
1099590072 12:84575545-84575567 CTGTGTTGAGGAAGTTCTCCTGG - Intergenic
1102350178 12:112186160-112186182 TTTTGCAGAGACAGTTTTCATGG + Intronic
1106945955 13:34827964-34827986 TCTTGCAGTGGAAGTTCTGAGGG - Intergenic
1108276391 13:48814402-48814424 TTTGGTAGAAGAAGTTCTCATGG - Intergenic
1110053915 13:70940735-70940757 TTTTGCAGAGGAAATATTCATGG + Intergenic
1113608043 13:111624223-111624245 TGGTGCAGACGATGCTCTCAGGG - Intronic
1117619555 14:57570537-57570559 GTGTGCAGAGGAAGATGGCAAGG + Intronic
1117775473 14:59179888-59179910 TTGTGATGTGGAATTTCTCATGG - Intergenic
1117853647 14:60003879-60003901 TTCTGAAGAGGAAGATCTCTAGG + Intronic
1119888948 14:78168280-78168302 TTCTGCAGACGCACTTCTCACGG + Intergenic
1121928589 14:97951436-97951458 TTATGCAGAGGAGGAACTCATGG - Intronic
1122412778 14:101534461-101534483 TTGGGCAGAGGAAGCAGTCAGGG + Intergenic
1125601186 15:40916566-40916588 TTGTGCAGAGCAAGGGCTGAGGG - Intergenic
1126357794 15:47814559-47814581 TTGTGCACAGGAAGTTTTCAAGG + Intergenic
1127346801 15:58109202-58109224 CTGTGCAGAACAAGTTCCCATGG + Intronic
1130577860 15:85108207-85108229 TGGTGCAAAGGAAGTGCTAAGGG + Intronic
1131333268 15:91522493-91522515 TCGTGCAGATAAAGTTCTCTGGG + Intergenic
1132365613 15:101254261-101254283 TTGAGCTGAGGCAGTTCTCCTGG + Intergenic
1133420728 16:5644378-5644400 TTGTGCAAAGGAAATGCCCATGG + Intergenic
1134068405 16:11245188-11245210 TGGTACAAAGGAAGTTCTCTAGG - Intergenic
1140421378 16:74822052-74822074 TTGGGCAGAGTAAGGTCTGAGGG - Intergenic
1140678447 16:77358988-77359010 TTATGCACAGGAAGTAATCATGG - Intronic
1141855407 16:86677754-86677776 TTGTGCAGAGGGCCTCCTCATGG - Intergenic
1145887159 17:28390292-28390314 TTGTGCAGAGGAAGTTCTCAGGG + Intronic
1147548982 17:41424715-41424737 ATGAGCTGAGGAACTTCTCATGG - Intergenic
1149348535 17:55764061-55764083 ATGAGAACAGGAAGTTCTCAAGG - Intronic
1155534915 18:26807090-26807112 TGGTGCATAGCAAGTGCTCATGG + Intergenic
1155610303 18:27659626-27659648 TAGTGCAGGTGAAGTTTTCAGGG - Intergenic
1158814829 18:61083209-61083231 AAGTGTAGTGGAAGTTCTCATGG + Intergenic
1161844308 19:6703193-6703215 TTATGGAGAAGAAGTTCCCAAGG - Intronic
1162514751 19:11141229-11141251 CTGTGCATGGGAAGTTTTCAAGG - Intronic
1164679076 19:30121975-30121997 TTGTCCAGGGCAAGTTCCCACGG + Intergenic
1166042285 19:40211243-40211265 TTGTGATCAGGGAGTTCTCAGGG + Intronic
1167901684 19:52627057-52627079 TTGTCCAGAAGAATTTCTCAAGG - Intronic
925024307 2:595640-595662 TCATGCAGAGGATGATCTCAGGG - Intergenic
925595694 2:5553356-5553378 TTGTTCAGAGGGAGGTCTAAAGG + Intergenic
926584372 2:14669838-14669860 GAGAGCAGAGGAAGATCTCATGG + Intergenic
926862815 2:17326722-17326744 GTGTGCAGAAGACTTTCTCAAGG - Intergenic
929899975 2:45992495-45992517 TTGTGCAATGGAAGTTGGCAGGG - Intronic
932593295 2:73079812-73079834 TGGTGCAGAGGAGGTAGTCAGGG + Intronic
935692211 2:105742245-105742267 TTGTGCTCAAGAACTTCTCATGG - Intergenic
937818003 2:126275057-126275079 TTGTGCAGAGGGATTTGACATGG + Intergenic
939821422 2:146961255-146961277 CTCTGCAGAGGATGTTCTCTGGG + Intergenic
940799188 2:158114561-158114583 TTATTCAGAAGAAATTCTCATGG - Intronic
941209194 2:162615156-162615178 TCGTGCAGAGGTAGTACTCAGGG - Intronic
942411209 2:175710702-175710724 CTGTGTAGGGGAAGTTCTCTTGG - Intergenic
945486281 2:210400112-210400134 TTGGGCATAGGAATTTTTCATGG + Intergenic
945683090 2:212937083-212937105 TTGGGCAAAAGAAGTTGTCAAGG - Intergenic
946664708 2:222036493-222036515 ACGTGCAGAGCAAGTTCCCAGGG + Intergenic
948087988 2:235266758-235266780 TGTTGCAGAGGATGTTCTGATGG - Intergenic
948928077 2:241112247-241112269 CTGTGCACCGGAAGTTCTCATGG - Exonic
1168750713 20:279264-279286 GCTTGCTGAGGAAGTTCTCACGG + Exonic
1169193228 20:3670596-3670618 TTGTGCAGAGGAAGTGGCAAAGG + Intronic
1172809937 20:37640218-37640240 TTGTACTGAGGAAGCACTCAGGG + Intergenic
1172849069 20:37947629-37947651 TGGTGCATAGGAGGTGCTCAGGG - Intergenic
1174097576 20:48101497-48101519 TTGGGCAGAGGAAGCTCCCTGGG - Intergenic
1175048264 20:56127692-56127714 TTATGCAGTGCAATTTCTCAAGG + Intergenic
1180049699 21:45325531-45325553 TTGGGGAGAGGAAGCTCTCCCGG - Intergenic
1182085133 22:27556136-27556158 TTGTGAAGAGGAAGGACTGAAGG + Intergenic
1183573149 22:38669318-38669340 GTGCGCAGAGGAGGTTCACACGG - Intronic
949092380 3:43698-43720 TTCTGCAAGGGAAGGTCTCAGGG + Intergenic
952890418 3:38036736-38036758 TTGTGCCGATGAAGTCCCCAGGG + Intergenic
953445420 3:42960758-42960780 TTTTGCAGAGAAAGTTTTGAGGG + Intronic
954941370 3:54376092-54376114 GTGTGCAGCGGGAGGTCTCATGG - Intronic
955059582 3:55483874-55483896 TTGTTCAGAGGACGTTCGGAGGG + Intronic
958103486 3:89044486-89044508 TGGTGAAGAGGAAGTACACAGGG - Intergenic
959548701 3:107629187-107629209 TTGTGAAGAGGAGGTTCTAACGG - Intronic
960713449 3:120553813-120553835 TTGTTCAGAGGAACTTCTAGTGG - Intergenic
962576165 3:136756883-136756905 TTATGCAGAGAAAGTCCTCCAGG - Intergenic
965242417 3:166219295-166219317 TTATGTAGACGAAGTTTTCAGGG - Intergenic
965697303 3:171422857-171422879 TTGTGCAGATGAAGATCCCAGGG - Intronic
966907324 3:184536538-184536560 TTGTGCATAGAATGTTTTCATGG + Intronic
967440698 3:189505122-189505144 TTGGGCAGAAGCAGTCCTCAGGG - Intergenic
968309216 3:197668757-197668779 TTGTGCAGAAGGATGTCTCAGGG + Intergenic
968316160 3:197727403-197727425 TTATGCAATGGAAGTTCACAGGG - Intronic
969202366 4:5616206-5616228 CTGTGCTGGGAAAGTTCTCAGGG - Intronic
972465158 4:39348704-39348726 TTTTGAAGAGGGAGTTCTGATGG - Intronic
974637233 4:64580664-64580686 TTTTGCAGTGAATGTTCTCACGG + Intergenic
976094386 4:81492142-81492164 TTTTGAAGAGGAAGTGGTCATGG - Intronic
976490018 4:85659734-85659756 TTGTGAAGAGGACTTTTTCAGGG + Intronic
978470792 4:109065146-109065168 TTGAGGAGGGGAAGTGCTCAGGG + Intronic
979177979 4:117689006-117689028 TTGTGGGGAGTTAGTTCTCAAGG - Intergenic
980116363 4:128683143-128683165 TTATGCAGTGGAAGATCTCAGGG + Intergenic
983667948 4:170203328-170203350 TAGTGCACTTGAAGTTCTCAAGG - Intergenic
984752167 4:183288598-183288620 TTCTGCAGCCGAAGTTTTCAAGG + Intronic
986015384 5:3752928-3752950 CTCTCCAGAGGAAGATCTCAGGG - Intergenic
986268969 5:6215290-6215312 TTGTGAAGATGAAGTCCTTAGGG + Intergenic
987263900 5:16231673-16231695 TTTTGCAGAGGAATTTTTCTAGG + Intergenic
988882701 5:35520672-35520694 TTTTGCAAAGGTAGTTCACAAGG + Intergenic
994983503 5:106905622-106905644 TTGAGGAGAGGAAGTAATCAAGG - Intergenic
997714704 5:136033551-136033573 TTTTGCAGGGGAAGCTTTCATGG + Intronic
999606626 5:153323908-153323930 GTGTGCAGAGAACATTCTCAGGG - Intergenic
1000674822 5:164107711-164107733 TTCTGCAGAGAAAGTTTTAATGG - Intergenic
1003566438 6:7226717-7226739 CTGAGGAGAGGAAGTTCCCATGG - Intronic
1005053489 6:21708012-21708034 TTGAGCAGAGAATGTTCTCCTGG + Intergenic
1005186173 6:23165198-23165220 CTGAGCAGAAAAAGTTCTCAAGG - Intergenic
1006013238 6:31059714-31059736 TTGTCCAGAGGAAGTAACCAAGG - Intergenic
1007179013 6:39915240-39915262 ATGTGCTGAGGAAGCACTCATGG - Intronic
1007384477 6:41511397-41511419 TTGGGGAGAGGAAGTTCTTTTGG - Intergenic
1007944157 6:45810424-45810446 TTTTGCTCAGGAAGCTCTCAGGG - Intergenic
1008730598 6:54477891-54477913 ATGTGCATAGGAATTTCTTAGGG + Intergenic
1011556971 6:88580788-88580810 TTGTGCAAAGGAAATTGCCAGGG - Intergenic
1011864880 6:91813117-91813139 GTGTGCAGAGGAAGTGCTGAAGG + Intergenic
1016452986 6:144202710-144202732 TTTTGAAGAGGAACTTCTCTGGG - Intergenic
1018609392 6:165632787-165632809 TTGGGCACATGAACTTCTCAGGG + Intronic
1022407828 7:30108684-30108706 CTGCACAGAGTAAGTTCTCAGGG - Intronic
1028720857 7:94029487-94029509 TTGTGCAGGGAGGGTTCTCATGG + Intergenic
1029600628 7:101561309-101561331 TTGTTCATGGAAAGTTCTCAGGG - Intergenic
1034986827 7:155521445-155521467 TTGTGCAGAGGGGATGCTCAGGG - Intronic
1035665497 8:1376921-1376943 TTCTGCAGACGCAGTTCTGAAGG + Intergenic
1036085262 8:5606850-5606872 GTGTGCAGAGGAGGTTTGCATGG - Intergenic
1036426317 8:8648191-8648213 TTGTGAAGGCGAATTTCTCATGG - Intergenic
1037014228 8:13882559-13882581 TTGTGCAGAGGAAGGTCAAGTGG - Intergenic
1037403733 8:18519765-18519787 TTGTGCAAAGTAAGCTCTCATGG - Intergenic
1038331247 8:26611217-26611239 TTGTTCCGAGAAAGTTCCCAGGG + Intronic
1039381221 8:37087334-37087356 TTGTGCAGAGTTAGTTCCCTGGG - Intergenic
1039606925 8:38888663-38888685 AAGAGCAGAGGAAGTGCTCATGG + Intergenic
1045016536 8:98005723-98005745 TTATGCATGGGAAGTGCTCAGGG - Intronic
1045107417 8:98906416-98906438 TTGTTCAGTAGTAGTTCTCATGG + Intronic
1045325377 8:101113869-101113891 ATGCTCAGAGGAAATTCTCATGG + Intergenic
1046793281 8:118344125-118344147 TTGTGCAGAGGAAGCCCTGTAGG + Intronic
1047050614 8:121107578-121107600 CTATGCAGAGGAAATTTTCAGGG - Intergenic
1048067758 8:130988188-130988210 TATTACTGAGGAAGTTCTCAAGG + Intronic
1049174065 8:141180606-141180628 TTGTGAAGACGAAGGTCTCTTGG - Intronic
1049546086 8:143231716-143231738 CTGTGCAGAGGAAGTTGTCCTGG - Intergenic
1049959443 9:724295-724317 GTGGGCAGAGGGAGTTATCAGGG + Intronic
1050843423 9:10183386-10183408 TTGCGCAAAGGAAGTGCTTAAGG + Intronic
1051290209 9:15537752-15537774 TTGGGAAGAGGAAGATATCAAGG + Intergenic
1052094824 9:24370620-24370642 TTGTGTTGAGGAGGTTCTCCTGG + Intergenic
1055617656 9:78089888-78089910 CTGTGCAGAGCAGGATCTCATGG + Intergenic
1056893419 9:90517509-90517531 CTCTGCAGAGAAAGTTGTCAGGG + Intergenic
1057582491 9:96299881-96299903 TTGGGCAGAGGCAGATATCAGGG - Intronic
1057872918 9:98731691-98731713 TGGAGCAAAGGGAGTTCTCAAGG + Intronic
1059485591 9:114624236-114624258 TTGTTGCGAGGAGGTTCTCATGG + Intronic
1062576473 9:137211255-137211277 TGGTGGAGAGGAAGTTATCCAGG + Intronic
1186738397 X:12491101-12491123 TTGTAGAGAGGAAGTACTGAAGG - Intronic
1187877481 X:23816283-23816305 TTGGGAAGAGGAAGGGCTCATGG - Intergenic
1189199162 X:39176926-39176948 TTGTGCATGGGAAGTGCTCAGGG - Intergenic
1189517843 X:41733340-41733362 TTGTACTTAGGAAGATCTCATGG - Intronic
1190177013 X:48158666-48158688 TTGTGCAGGGAAAAATCTCAAGG + Intergenic
1191743969 X:64465472-64465494 CTGGGCAGGGGAAGTTCTCTTGG + Intergenic
1198117320 X:133556726-133556748 TTATGTAGAGGAGGTTATCAGGG + Intronic
1198497731 X:137209869-137209891 TTGTGAAGTGGAATTTGTCAGGG - Intergenic
1199915276 X:152332961-152332983 TTGTGCAAAGGGAGTTGTGATGG - Intronic
1200067569 X:153511376-153511398 TTGTGCCGGGGAGGTTCTCCCGG + Intergenic