ID: 1145889040

View in Genome Browser
Species Human (GRCh38)
Location 17:28402158-28402180
Sequence GCTGATGGGCAGCCATGGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 336}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145889040_1145889053 21 Left 1145889040 17:28402158-28402180 CCCAGCCATGGCTGCCCATCAGC 0: 1
1: 0
2: 4
3: 41
4: 336
Right 1145889053 17:28402202-28402224 ATGAGGAACCAGACACAGGTGGG 0: 1
1: 0
2: 2
3: 45
4: 398
1145889040_1145889047 -4 Left 1145889040 17:28402158-28402180 CCCAGCCATGGCTGCCCATCAGC 0: 1
1: 0
2: 4
3: 41
4: 336
Right 1145889047 17:28402177-28402199 CAGCCCGTTTCGGGCAGCACTGG 0: 1
1: 0
2: 1
3: 3
4: 83
1145889040_1145889051 17 Left 1145889040 17:28402158-28402180 CCCAGCCATGGCTGCCCATCAGC 0: 1
1: 0
2: 4
3: 41
4: 336
Right 1145889051 17:28402198-28402220 GGACATGAGGAACCAGACACAGG 0: 1
1: 0
2: 0
3: 20
4: 259
1145889040_1145889050 4 Left 1145889040 17:28402158-28402180 CCCAGCCATGGCTGCCCATCAGC 0: 1
1: 0
2: 4
3: 41
4: 336
Right 1145889050 17:28402185-28402207 TTCGGGCAGCACTGGACATGAGG 0: 1
1: 0
2: 0
3: 8
4: 121
1145889040_1145889052 20 Left 1145889040 17:28402158-28402180 CCCAGCCATGGCTGCCCATCAGC 0: 1
1: 0
2: 4
3: 41
4: 336
Right 1145889052 17:28402201-28402223 CATGAGGAACCAGACACAGGTGG 0: 1
1: 0
2: 0
3: 27
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145889040 Original CRISPR GCTGATGGGCAGCCATGGCT GGG (reversed) Exonic
900082551 1:869671-869693 ACTGATGGGCTGCTATGGCAGGG - Intergenic
900234002 1:1577932-1577954 GCCCATGGGCAGCCATGGACGGG - Intergenic
900238342 1:1603103-1603125 GCTCGTGGGCAGCCCTGGCCAGG + Intergenic
900582574 1:3416368-3416390 GCTAGTGGGCAGCCAGGGCTAGG + Intronic
900591412 1:3461939-3461961 GCAGAAGGGCAGCCCTGCCTCGG + Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
900607347 1:3529763-3529785 GCAGGTGGACAGGCATGGCTGGG + Intronic
900626033 1:3609079-3609101 TCTGATGAGCAGGCAGGGCTTGG - Intronic
901857680 1:12054647-12054669 GCTGATGGGCAGCTCCTGCTAGG + Intergenic
902553595 1:17233745-17233767 CCAGATGGTCAGCCAGGGCTTGG - Intronic
902925592 1:19693876-19693898 GCTGTTGGGGAGCCCTGGGTGGG + Intronic
903683239 1:25111700-25111722 GCTGAACTGCAGCCAGGGCTGGG + Intergenic
904365733 1:30010008-30010030 GTCCATGGGCAGCCATGGGTGGG + Intergenic
904371191 1:30048488-30048510 GCAGATGGGCAGCCCTGGGCAGG - Intergenic
905345281 1:37307065-37307087 GGTGACGGGCAGACAAGGCTTGG - Intergenic
906331979 1:44893277-44893299 GGGGATAGGCAGCCATGGCAAGG - Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
909282314 1:73770878-73770900 GTTCATGGGCAGCCATGGGTGGG - Intergenic
909599642 1:77448266-77448288 GCCCATGGGAAGCCATGGATGGG - Intronic
910371779 1:86523996-86524018 GCAGATGGGCAGGCAGTGCTGGG + Intergenic
912497133 1:110098808-110098830 GCTGATGGGCAGAGGTGGATGGG + Intergenic
912570933 1:110620434-110620456 GACGATGGGCAGCCATGCCTGGG - Intronic
913298536 1:117345801-117345823 GCTGAGGGGCAGCTCTGACTGGG + Intergenic
913360036 1:117970369-117970391 GCTGACGAGCAGCCCAGGCTTGG + Intronic
914846737 1:151287645-151287667 GCTGACGGGCGGGCAGGGCTGGG + Exonic
915185097 1:154098693-154098715 GTCCATGGGCAGCCATGGGTGGG + Intronic
916515445 1:165512494-165512516 GGTGTTGGGCACCTATGGCTGGG - Intergenic
916896156 1:169164184-169164206 TCTGATGTGCAACCAAGGCTAGG + Intronic
920515180 1:206580010-206580032 GGTGATGGGAAGCCCTGTCTGGG - Intronic
921009107 1:211123466-211123488 GCAGATGGGCAGATATGGATAGG + Intronic
922169009 1:223139549-223139571 GCTGTTTGGCAGCCTTGGCCAGG - Intronic
922592171 1:226785457-226785479 GCTCCTGGGCAGTCAGGGCTTGG + Intergenic
922674667 1:227542937-227542959 ACTGATGGGCTGCTATGGCAGGG + Intergenic
922796753 1:228343285-228343307 GGTGATGTGCAGACAGGGCTGGG + Intronic
923391370 1:233516228-233516250 GTCCATGGGCAGCCATGGGTGGG - Intergenic
923685527 1:236150847-236150869 GCAGCGGGACAGCCATGGCTGGG - Intronic
1064010323 10:11730267-11730289 GTGCATGGGCAGCCATGGGTGGG - Intergenic
1065270643 10:24029905-24029927 TCTGCTGGGCAGCCATGGTTAGG + Intronic
1065830205 10:29608361-29608383 GCAGTGGGGAAGCCATGGCTGGG + Intronic
1066495496 10:35938082-35938104 GCTGAAGGGCACCCAGGGCTAGG - Intergenic
1066646864 10:37619163-37619185 GCTGAAGGGCAACAAGGGCTTGG + Intergenic
1067258690 10:44667156-44667178 GTCCATGGGCAGCCATGGGTGGG + Intergenic
1067717423 10:48700133-48700155 GCTGATGGCCAGCCTTGGGGTGG - Intronic
1068287662 10:54961534-54961556 GTCCATGGGCAGCCATGGGTGGG - Intronic
1069060734 10:63891916-63891938 GCTCCTGAGCTGCCATGGCTGGG + Intergenic
1069249114 10:66245958-66245980 GCTCATGGGCAACCATTGGTGGG + Intronic
1071166784 10:82816529-82816551 GTCCATGGGCAGCCATGGGTGGG + Intronic
1071600348 10:86955902-86955924 GCTGATGGGCAGCCCTGCAGGGG - Intronic
1072695503 10:97600141-97600163 TCTGATGGCCAGCTATGCCTTGG + Exonic
1075007805 10:118842903-118842925 GCCCATGGGCAGCCATAGGTGGG - Intergenic
1075799935 10:125147320-125147342 CCTGATGGGCAGCCAGGGTGGGG - Intronic
1076596397 10:131625284-131625306 CCTGAGGGGCAGCGAGGGCTGGG - Intergenic
1076783358 10:132736668-132736690 GCTGCTGGGCAGCCTGGCCTTGG - Intronic
1076880020 10:133235602-133235624 CCTGATGCGCTGCCATGGGTAGG - Intergenic
1077012811 11:386323-386345 GTGCATGGGCAGCCATGGGTGGG - Intergenic
1077133098 11:984416-984438 GCTGAGTGGCAGCCCTCGCTCGG - Intronic
1077415166 11:2421372-2421394 GCTGCTGAGCAGCCTTGGGTGGG - Intronic
1077434222 11:2531035-2531057 GCTGACAGACAGCCCTGGCTGGG - Intronic
1078107713 11:8369019-8369041 GCTACTGGGCAGCCATGGAAGGG + Intergenic
1079472307 11:20790049-20790071 GCCCATGGGCAGCCATGGATAGG + Intronic
1081701897 11:45157672-45157694 GCTGATGGGCAGGCAGCCCTCGG + Intronic
1082780745 11:57285742-57285764 GCTGATGTACAGCCCTGCCTTGG - Intergenic
1084518040 11:69646953-69646975 GCTGATGGGCCGCCCTAGATTGG + Intronic
1085032253 11:73279890-73279912 TCTGATGGGCAGCCAGGGTTGGG + Intronic
1089495033 11:118903414-118903436 GCTGTGGGGCCGCCATGGCTGGG + Exonic
1089609773 11:119662897-119662919 GCTACTGGGCAGCCTGGGCTGGG + Exonic
1090627585 11:128619759-128619781 GCAGAAGGGCAGGCAGGGCTGGG + Intergenic
1091439735 12:503329-503351 TGTGAGTGGCAGCCATGGCTTGG - Intronic
1092744578 12:11661415-11661437 ACTAATGGCCAGCAATGGCTGGG + Intronic
1096532249 12:52249368-52249390 GCTCATGGTCAGCCAGGCCTGGG + Intronic
1096752362 12:53769155-53769177 TCTGATTGGCAGCCAAGTCTGGG + Intergenic
1097446486 12:59678636-59678658 GCTCATGGGCAGCCACGGGTAGG + Intronic
1098053815 12:66482309-66482331 CCTGATGAGCTGACATGGCTGGG + Intronic
1098465634 12:70783592-70783614 GTTCATGGGCAGCCATGGGTGGG + Intronic
1098801075 12:74958938-74958960 ACTGAAGGGCAGCCATTTCTTGG + Intergenic
1099683413 12:85856905-85856927 GTTCATGGGCAGCCATGGGTGGG + Intergenic
1101877077 12:108603205-108603227 CCTGGTGGGCAGCCATGGCTAGG + Intergenic
1101877190 12:108603598-108603620 CCTTCTGGGCAGCCATGGCCAGG - Intergenic
1102832639 12:116019295-116019317 GCAGTTGGGCAGCAAGGGCTTGG - Exonic
1103561782 12:121796642-121796664 GCTCATGGGCAGCCAAGGCCTGG - Intronic
1103959998 12:124603456-124603478 ACTGATGAGCAGCCAGGGCAGGG + Intergenic
1104053502 12:125211929-125211951 ACTGATGGGCACTAATGGCTTGG + Intronic
1105308452 13:19185542-19185564 GCTAGTAGGCAGCCATGACTGGG - Intronic
1105411899 13:20177705-20177727 GCTGCTGGGCAGCGAGGCCTGGG - Intergenic
1105931655 13:25058146-25058168 GCCAGTGGGCAGCCCTGGCTGGG - Intergenic
1109470652 13:62799563-62799585 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1111200138 13:84926059-84926081 GTTGATGGGCAGTAATGGCAGGG + Intergenic
1111595372 13:90404079-90404101 GTTCATGGGCAGCCATGGGAAGG - Intergenic
1113200335 13:107860425-107860447 TCTGATGTGCAGCCAAGGTTGGG - Intronic
1113339154 13:109404820-109404842 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1113571916 13:111363816-111363838 GCTGATGGGCAGCTATGGGAAGG + Intergenic
1113773476 13:112928178-112928200 GGTGGTGGGCAGCCGTTGCTGGG + Intronic
1116313744 14:43360160-43360182 GTCCATGGGCAGCCATGGATGGG + Intergenic
1117537819 14:56718729-56718751 TCTAATGTGCAGCCAGGGCTGGG - Intronic
1118681775 14:68249000-68249022 GCAGAGGGGCAGCAGTGGCTGGG + Intronic
1118981973 14:70724468-70724490 GGTGAGGGGCAGGCAGGGCTGGG + Intronic
1119729100 14:76939889-76939911 GAGGATGGGCAGCCAAGGCCTGG + Intergenic
1119854775 14:77891317-77891339 GCTGTGGAGCAGCCATAGCTGGG + Intronic
1120074971 14:80145769-80145791 GCTGATGTGAAGCCATTTCTGGG + Intergenic
1121695344 14:95907979-95908001 GTCCATGGGCAGCCATGGGTGGG + Intergenic
1122081876 14:99272476-99272498 GCTGTTGCGCAGCCGGGGCTCGG - Intergenic
1122307178 14:100773409-100773431 GCTGGAGGGCCGCCAGGGCTGGG + Intergenic
1122386060 14:101349089-101349111 GTTCATGGGCAGCCATGGGTGGG + Intergenic
1122809351 14:104280365-104280387 AATGATGGGAAGCCATGGGTGGG + Intergenic
1122969633 14:105147286-105147308 GCTGAGGGGCTCCCAGGGCTGGG + Intronic
1123105454 14:105839245-105839267 CCAGGTGGGCAGCCATGGGTTGG + Intergenic
1125718119 15:41831091-41831113 GTCCATGGGCAGCCATGGGTGGG - Intronic
1127784261 15:62342251-62342273 ACTGCTGGGCAGTCATCGCTAGG - Intergenic
1128799836 15:70490396-70490418 CCTGATGGGCAGCTTGGGCTGGG - Intergenic
1131027615 15:89158036-89158058 GAAGATGGGGAGGCATGGCTTGG + Intronic
1131232102 15:90666833-90666855 GCTGAGGAGCAGCCAGGCCTGGG + Intergenic
1132582144 16:689784-689806 GCTGATAGACAGCCCTGGATTGG - Exonic
1132867298 16:2099803-2099825 GCTGAGGGGCAGGAAGGGCTGGG + Intronic
1132898208 16:2238758-2238780 CCTTAGGGGCAGCCATGGCCTGG + Intergenic
1133172843 16:3992534-3992556 GCAGACGGGCAGTCAGGGCTGGG - Intronic
1133590250 16:7235598-7235620 ATTGATGGGCAGCCATATCTTGG + Intronic
1133787772 16:8986373-8986395 GCTGATGGGATGCCAAGCCTGGG + Intergenic
1134524476 16:14933312-14933334 GCTGAGGGGCAGGAAGGGCTGGG - Intronic
1134548424 16:15127629-15127651 GCTGAGGGGCAGGAAGGGCTGGG + Intronic
1134712065 16:16331799-16331821 GCTGAGGGGCAGGAAGGGCTGGG - Intergenic
1134719922 16:16375092-16375114 GCTGAGGGGCAGGAAGGGCTGGG - Intergenic
1134947504 16:18336793-18336815 GCTGAGGGGCAGGAAGGGCTGGG + Intergenic
1134954764 16:18376895-18376917 GCTGAGGGGCAGGAAGGGCTGGG + Intergenic
1136735235 16:32461327-32461349 ACTGATGGGCTGCTATGGCAGGG + Intergenic
1138130431 16:54474844-54474866 GCTCATGGGCAGCCCAAGCTGGG - Intergenic
1139428172 16:66895932-66895954 GGTGAGGGGGAGCCATGGTTCGG - Intergenic
1139956159 16:70693984-70694006 TCTGCTGGGCAGCCAGGCCTAGG - Intronic
1140103507 16:71938589-71938611 GTCCATGGGCAGCCATGGGTGGG - Intronic
1141206060 16:81933956-81933978 CCTGATGGGCAGTCAGAGCTGGG + Intronic
1141440170 16:84025097-84025119 ACTGATGTACAGCCAGGGCTGGG + Intronic
1141559145 16:84855044-84855066 GCCCATGGGAAGCCATGTCTCGG - Intronic
1142262998 16:89051260-89051282 GCTGAGGGGCAGGGAGGGCTGGG - Intergenic
1142298335 16:89241380-89241402 TCTGAAGGGCAGCCGGGGCTGGG + Intergenic
1203017845 16_KI270728v1_random:368266-368288 ACTGATGGGCTGCTATGGCAGGG - Intergenic
1203036180 16_KI270728v1_random:641424-641446 ACTGATGGGCTGCTATGGCAGGG - Intergenic
1144666109 17:17103311-17103333 GCTGATGGGGACACATGGCTGGG - Intronic
1144946394 17:18971604-18971626 GGTGGGGGCCAGCCATGGCTGGG + Exonic
1144997341 17:19279290-19279312 GCTCATTGGGAGCCCTGGCTGGG + Intronic
1145050300 17:19654502-19654524 GCTGGTGGGCTGGCATTGCTGGG + Intronic
1145217067 17:21060739-21060761 GTCCATGGGCAGCCATGGGTAGG + Intergenic
1145241086 17:21241434-21241456 GAGGATGGGCAGCCAGGCCTGGG - Exonic
1145414293 17:22702696-22702718 GGTGATGAGCAGCCATGGGGTGG + Intergenic
1145811831 17:27768947-27768969 GCTGTGGGGCAGCTCTGGCTGGG + Intronic
1145889040 17:28402158-28402180 GCTGATGGGCAGCCATGGCTGGG - Exonic
1146401029 17:32500139-32500161 GCTGATGGGCAACACTGGCTGGG + Intronic
1148737778 17:49874478-49874500 ACAGAGGGGCAGCCCTGGCTGGG - Intergenic
1149576293 17:57715838-57715860 GGTGATGGGCAGCCTCGGGTGGG + Intergenic
1151150975 17:72086572-72086594 GCTCATGGGCAGTAATGGTTTGG + Intergenic
1151460927 17:74253546-74253568 GCTGATGGGCAACGGAGGCTGGG - Intronic
1151808244 17:76420125-76420147 GTTGATTAGCAGCCAAGGCTTGG - Intronic
1151895161 17:76975085-76975107 GTGTATGGGCAGCCATGGGTGGG - Intergenic
1152289989 17:79434853-79434875 GGTGATGGCCAAGCATGGCTGGG + Intronic
1152390436 17:80001017-80001039 GCTGAGGGGCAGCCAGGGAGGGG + Intronic
1152427077 17:80223927-80223949 AATGCTGGGCGGCCATGGCTGGG - Intronic
1152690398 17:81715390-81715412 GCTGAGGGGGATCCCTGGCTGGG + Intronic
1152864223 17:82712707-82712729 GTTCATGGGCGGCCATGGGTGGG + Intergenic
1153522985 18:5969361-5969383 GCTGCTGGGGGGCCAGGGCTGGG - Intronic
1157342575 18:46792308-46792330 ACTGATGTGCAGCCAGGGCTGGG + Intergenic
1159186683 18:64984073-64984095 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1160123883 18:76153361-76153383 GCTGATAGGTGGCCCTGGCTGGG - Intergenic
1160800705 19:966819-966841 GCAGCTGGGCCGCCATGGCCAGG - Exonic
1160865176 19:1253101-1253123 GCTAATGGGCGGGCATGACTCGG - Intronic
1161588200 19:5117008-5117030 GCAGAGGGGCAGCCATCACTTGG - Intronic
1161950190 19:7463567-7463589 GCTGTGGGGCAGCCATGGGGAGG - Intronic
1162583843 19:11546997-11547019 GGTGGTGGGCAGCCTGGGCTGGG + Intronic
1163603347 19:18261464-18261486 TCTGATGGTCAGAGATGGCTGGG + Intronic
1163755537 19:19104421-19104443 GCTTATGGCCCACCATGGCTCGG + Intronic
1163861121 19:19743378-19743400 GGGGATGGGCTCCCATGGCTGGG + Intergenic
1165319608 19:35077039-35077061 GCGGCTGGTCATCCATGGCTGGG + Intergenic
924978727 2:200878-200900 GGTGATTGGGAGTCATGGCTGGG + Intergenic
925160239 2:1678307-1678329 GGTGATGGGGAGCCATGGGAGGG - Intronic
925177240 2:1794253-1794275 GCTGAGGGCCAGCGATGGCGAGG - Intronic
925361687 2:3284448-3284470 GCTTATGTGCAGCCGTGGCGCGG - Intronic
925628426 2:5865149-5865171 GCTGATTGGCAACCATGTCCAGG + Intergenic
926785710 2:16516615-16516637 TCTGATGTGCAGCCAAGGTTAGG + Intergenic
927266897 2:21162160-21162182 GTTCATGGGCAGCCATGGGTGGG + Intergenic
928723616 2:34147592-34147614 GTCCATGGGCAGCCATGGGTGGG + Intergenic
928950467 2:36808960-36808982 TCAGATGGGCAGCCATGGCTGGG - Exonic
929124673 2:38512402-38512424 GCTGTTGGGCAGCAAAGGCTGGG - Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930153116 2:48078259-48078281 GCTAATGCACAGCCATGGTTGGG - Intergenic
930946642 2:57084227-57084249 GTCCATGGGCAGCCATGGGTGGG + Intergenic
931300493 2:60973801-60973823 GTCCATGGGCAGCCATGGGTGGG - Intronic
933063595 2:77768184-77768206 GTTCATGGGCAGCCATGGGTGGG - Intergenic
934963769 2:98701905-98701927 TCTGATTGGCAGCCAGGGTTAGG - Intronic
938299875 2:130202648-130202670 GCTGAAAGGCACCCATGGCAAGG - Intergenic
938456838 2:131471837-131471859 GCTGAAAGGCACCCATGGCAGGG + Intronic
940612193 2:156006346-156006368 GTCCATGGGCAGCCATGGGTAGG + Intergenic
943023471 2:182601896-182601918 GTCCATGGGCAGCCATGGGTGGG + Intergenic
943064117 2:183069276-183069298 GTCCATGGGCAGCCATGGGTGGG - Intergenic
943426987 2:187749895-187749917 GTCCATGGGCAGCCATGGATGGG + Intergenic
943684729 2:190806303-190806325 GCAGATGGGCATCCAGTGCTTGG - Intergenic
943942733 2:194020335-194020357 GCTGTTGGGCCGGCACGGCTGGG - Intergenic
945891625 2:215436287-215436309 GCTGATGGCCCGCCAGGACTGGG + Intergenic
945929395 2:215840016-215840038 GCTGATGGGCAGCCACAACTTGG - Intergenic
946901759 2:224379944-224379966 GCAGGTGGGCACCCATAGCTGGG + Exonic
946904245 2:224401088-224401110 GCTGATAGGCATGCATGGATTGG + Exonic
948428438 2:237902693-237902715 TCTGATGTGCAGGCAGGGCTGGG - Intronic
949060854 2:241956560-241956582 GATGATGGGCAGACATGGCAGGG + Intergenic
1168799277 20:634042-634064 GCCGAGGGGCCGCCTTGGCTTGG - Intergenic
1169190307 20:3654765-3654787 GCTGCTGGGAAGCCCTGGATCGG - Intergenic
1169309362 20:4521879-4521901 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1170625025 20:18023726-18023748 GCTGGTGGGCAGAGATGCCTGGG - Intronic
1171329548 20:24325616-24325638 GATGACAGGCAGCCATGGCCAGG - Intergenic
1171385029 20:24764192-24764214 GCTGCTCGGCTGCCATGGCCTGG - Intergenic
1171425906 20:25048524-25048546 TCTGATGTGCAGCCAGGGCTGGG + Intronic
1172347045 20:34209919-34209941 GTCCATGGGCAGCCATGGGTGGG - Intronic
1173701607 20:45076715-45076737 TCAGATGGGGAGCCATGACTGGG + Exonic
1175045978 20:56106102-56106124 CCTGAGGGGCAGCAGTGGCTTGG + Intergenic
1175303164 20:57957273-57957295 GCTGATGTGAAGCCATGGGGAGG - Intergenic
1178499863 21:33116836-33116858 GCAAATAGGTAGCCATGGCTTGG + Intergenic
1178627039 21:34227022-34227044 TCTGATGTGAAGCCAGGGCTGGG + Intergenic
1179027410 21:37691210-37691232 GCAGATGGCCAGGTATGGCTAGG + Intronic
1179317828 21:40260639-40260661 GCTGATGGACAGGCAAGGCTTGG - Intronic
1179623539 21:42633984-42634006 GCTGATGGCGAGCTCTGGCTGGG - Intergenic
1180071269 21:45436872-45436894 GCTGGGGGGCAGCCATGGCTGGG + Intronic
1180229856 21:46420709-46420731 GGTGCTGGGCACCCATGTCTCGG + Intronic
1180799569 22:18625518-18625540 GCTGAAGGGCAGTCATGCCCAGG - Intergenic
1181222147 22:21369748-21369770 GCTGAAGGGCAGTCATGCCCAGG + Intergenic
1181637907 22:24182742-24182764 GCTGAAGGGCAGTCATGCCCAGG + Intronic
1181964586 22:26647615-26647637 GCTGGGGGCCAGCCATGGCAGGG + Intergenic
1182489742 22:30663581-30663603 GATGATGGGCCGGCATGACTTGG + Exonic
1183081968 22:35462542-35462564 GAGGATGGGCAGCCCTGCCTGGG + Intergenic
1183647490 22:39134876-39134898 GGTGATGGCCAGCCGTGGCATGG - Intronic
1184235238 22:43179758-43179780 TCTGATGGGCACTCATGTCTTGG - Intronic
1184406870 22:44305391-44305413 GCTGAGGGCCAGCCCTGGCCAGG - Intronic
1185274424 22:49944203-49944225 GCTTGTGGCCAGCCATGGCCTGG - Intergenic
1185284655 22:49994865-49994887 ACTGCTGGGCACCCCTGGCTGGG + Exonic
1185345318 22:50308130-50308152 TCTGAGGGGAGGCCATGGCTTGG + Intergenic
949509672 3:4757298-4757320 GCTGAAGGGCTGCCAGGGCTGGG - Intronic
950189245 3:10965295-10965317 GCTGATGGGAGGCCCTGGCAGGG + Intergenic
950571608 3:13803634-13803656 GCTGGTGTGCAGCCAAGGTTGGG + Intergenic
951047252 3:18053764-18053786 TCAGATGGGCAGCCATGTTTGGG + Intronic
951264702 3:20552413-20552435 GTCCATGGGCAGCCATGGGTGGG + Intergenic
951786343 3:26423529-26423551 ACTGGTGGGCAGCAATGGCAGGG - Intergenic
953406417 3:42662156-42662178 GCAGGTGGGCAGCCTTGCCTGGG - Intronic
954198849 3:49012437-49012459 TCTCATGGGCAGCTATGGCCCGG - Exonic
954279324 3:49564809-49564831 GCACAGGGGCTGCCATGGCTAGG - Intronic
954397947 3:50302941-50302963 GCAGGTGGGCTGCCATGGCACGG + Exonic
954650885 3:52162191-52162213 GTCCATGGGCAGCCATGGGTGGG + Intergenic
956627712 3:71283069-71283091 GCAGATGGGTACCCATGGCCTGG - Intronic
957150068 3:76475390-76475412 GGTGATGTGCAGCCATGGTGAGG + Intronic
958498396 3:94874770-94874792 GTCCATGGGCAGCCATGGGTGGG + Intergenic
959476818 3:106821849-106821871 GTTTATGGGTAGCCATGGGTGGG - Intergenic
959739157 3:109695752-109695774 GCTGCTGGGTAGCCATGGAATGG + Intergenic
961742169 3:129039752-129039774 GCTGGCAGGCAGCCAAGGCTTGG - Exonic
962105395 3:132383629-132383651 TCAGATCTGCAGCCATGGCTTGG + Intergenic
962184051 3:133239518-133239540 TCTGATGCGCAACCAGGGCTGGG + Intronic
962211998 3:133487102-133487124 GCCTATGGGCGGCCATGGGTGGG + Intergenic
962343983 3:134606543-134606565 CCTGAAGGACAGCCAGGGCTAGG - Intronic
962443287 3:135443010-135443032 TCTGATAGGCAGGCAGGGCTTGG - Intergenic
962591066 3:136890184-136890206 GCTGGTGGGCTGGCATTGCTGGG + Intronic
963908130 3:150791099-150791121 GATGATGGGCAGCAGTGACTGGG + Intergenic
965542065 3:169880349-169880371 GTCCATGGGCAGCCATGGGTGGG - Intergenic
965611346 3:170547053-170547075 TCTAATGTGCAGCCATGGCTGGG + Intronic
967101695 3:186221213-186221235 GCTGAGGGGCAGGCAAGGCCAGG + Intronic
967890484 3:194360995-194361017 GCTGGTGGGCTGCCAAGCCTGGG - Exonic
968614806 4:1572635-1572657 GCTGGGGGACATCCATGGCTTGG + Intergenic
968685152 4:1952899-1952921 GCTGTGGGGCTGCCATGGCCTGG - Intronic
968980761 4:3848293-3848315 GTCCATGGGCAGCCATGGGTGGG + Intergenic
969202721 4:5618483-5618505 GCTCAGGGGCAGCCACGGCCTGG + Exonic
971092434 4:23360963-23360985 GTCCATGGGCAGCCATGGGTGGG - Intergenic
971714093 4:30153441-30153463 GCTCATGGGCAGCCATGGTTGGG + Intergenic
971869380 4:32216121-32216143 GTCCATGGGCAGCCATGGGTGGG + Intergenic
975040852 4:69743421-69743443 GTCCATGGGCAGCCATGGGTGGG + Intronic
978149352 4:105415089-105415111 GCCCATGGGCAGCCATGGTTAGG + Intronic
978301045 4:107270079-107270101 GTCCATGGGCAGCCATGGGTGGG + Intronic
978578158 4:110206579-110206601 GCTGCTGGGGAGCCATGGTCAGG - Intergenic
978659532 4:111108188-111108210 GCTGGAGGGGAGGCATGGCTTGG + Intergenic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
979956157 4:126955984-126956006 GTCTATGGGCAGCCATGGGTGGG - Intergenic
983069698 4:163254015-163254037 GTCCATGGGCAGCCATGGGTGGG + Intergenic
984275738 4:177607301-177607323 GCTGGTGGGCGGGCATTGCTGGG + Intergenic
984967362 4:185151432-185151454 GCTGATGGGAAGCCATACATGGG - Intergenic
985069576 4:186154900-186154922 CCTTTTGGGCAGCCAGGGCTGGG - Intronic
985581053 5:695335-695357 CCGGACGGGCAGCCATGGCCAGG - Intergenic
985595678 5:786667-786689 CCGGACGGGCAGCCATGGCCAGG - Intergenic
985607859 5:868220-868242 GCTGTTTGGGAGGCATGGCTGGG - Intronic
986387382 5:7247900-7247922 GCTGATAGGCAGACAGGCCTAGG + Intergenic
987116192 5:14728647-14728669 GCTGAGTGACAGCTATGGCTTGG + Intronic
989730456 5:44641772-44641794 GTCCATGGGCAGCCATGGGTGGG + Intergenic
990312683 5:54554794-54554816 TCTGAGGAGCAGCCATGGCCTGG + Intergenic
992359790 5:76025291-76025313 GCTGAGGGGCATTCCTGGCTGGG + Intergenic
994201489 5:96981596-96981618 TCTGATGGGAAGAGATGGCTAGG + Intronic
996160295 5:120153778-120153800 GCTGTTTGGCAGCCATGGTGAGG + Intergenic
997779977 5:136647227-136647249 GCTGATGGGCATGTAGGGCTAGG - Intergenic
998882925 5:146662426-146662448 TCTGATGTGCAGCCAAGGTTGGG - Intronic
1000302563 5:159969297-159969319 GCTGCTGGGGGGCAATGGCTGGG - Intronic
1001253968 5:170169682-170169704 GCTGGTGGGCACGCATCGCTTGG + Intergenic
1001327243 5:170738034-170738056 TCTGATGTGCAGCCAGGGCAGGG - Intergenic
1001949458 5:175806111-175806133 GGTGATGGGGAGCCATTGCAGGG - Intronic
1003402645 6:5803523-5803545 TCTGAGGGGCAGCCTGGGCTTGG + Intergenic
1006908344 6:37547890-37547912 GCTGAGGGGAGGCCAAGGCTTGG + Intergenic
1007288483 6:40765721-40765743 TCTAATGGGCAACCAGGGCTGGG - Intergenic
1008074464 6:47131471-47131493 GCTGAGGGGCAGCAATGGGGTGG - Intergenic
1009844765 6:69121735-69121757 GATGATGGGCAGCCAGGCGTAGG + Intronic
1011431850 6:87295715-87295737 GCTGACGGTCAGCCATGGTGTGG - Intronic
1011727966 6:90229980-90230002 GCTAATATGCAGCCAGGGCTGGG - Intronic
1012666792 6:101981115-101981137 GCTTCTGGGCAGGCATGGCTGGG - Intronic
1013576400 6:111487155-111487177 GCTGACTGGCAGGCATTGCTGGG + Intergenic
1016568352 6:145484817-145484839 GAAGATAGGCAGCCATGACTTGG - Intergenic
1016844680 6:148558892-148558914 GCTGAAGAGTAGCGATGGCTGGG - Intergenic
1017445759 6:154505834-154505856 GCTGATCAACAGCCAAGGCTAGG + Intronic
1018802973 6:167237666-167237688 GCCGATGAGGAGGCATGGCTGGG + Intergenic
1019131654 6:169881432-169881454 TCTGAATAGCAGCCATGGCTTGG - Intergenic
1019791856 7:3019392-3019414 TCTGACCGGCAGCCAGGGCTGGG + Intronic
1020001394 7:4758251-4758273 GCAGGTGGGCAGCAATGGCTGGG - Intronic
1021677681 7:23097504-23097526 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1021793970 7:24234720-24234742 TCTAATGGGCAGCCAAGGATGGG - Intergenic
1022527688 7:31049138-31049160 GCTAATGTGCAGCCATGGTTAGG - Intergenic
1022977143 7:35569198-35569220 TCTGATGGGTAGACATGACTGGG + Intergenic
1023080529 7:36522223-36522245 GCTCAGAGGCAGCCGTGGCTTGG - Intronic
1023222425 7:37932936-37932958 GGTGATGGGCCTCCATGACTTGG - Intronic
1026393578 7:69928223-69928245 GTCCATGGGCAGCCATGGGTGGG + Intronic
1026837439 7:73648051-73648073 CCTGTGGGGCAGCCATGGCCCGG + Intergenic
1029701839 7:102252326-102252348 GCTGAAGGGGAGCCATGCCGAGG - Exonic
1029713809 7:102314736-102314758 GCCCATGGGTGGCCATGGCTGGG - Intronic
1031837025 7:126690947-126690969 GTCCATGGGCAGCCATGGGTGGG + Intronic
1031922100 7:127609533-127609555 GCAGATGGGGAGGCATGGCTGGG - Intergenic
1033249647 7:139747684-139747706 GCTGATGGGTCACCCTGGCTTGG - Intronic
1033604943 7:142920012-142920034 TCTGATGGGCAGTCTTGGTTAGG - Intronic
1033832426 7:145270130-145270152 GCAGACGGGCAGCCTGGGCTTGG - Intergenic
1034090522 7:148360050-148360072 GCAGATTGGCAGCCATGGGTTGG + Intronic
1035275094 7:157743555-157743577 GCTCCTGGCAAGCCATGGCTGGG + Intronic
1035275105 7:157743606-157743628 GCTCCTGGCAAGCCATGGCTGGG + Intronic
1036178516 8:6563023-6563045 GCTGCTACGCTGCCATGGCTGGG + Exonic
1036629389 8:10499842-10499864 TCTCAAGGGCAGCAATGGCTTGG + Intergenic
1036798376 8:11771848-11771870 GCTGATGGGCACCTTTGGCTGGG + Intronic
1037706018 8:21315875-21315897 GGTGATGGTCAGCCCTGGCAAGG - Intergenic
1037777882 8:21847729-21847751 GTTCATGGGCAGCCATGGGCGGG + Intergenic
1039828681 8:41195556-41195578 GCTTGTGGGCAGCCAGGGCAGGG - Intergenic
1041274418 8:56142556-56142578 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1042337035 8:67640098-67640120 GTCCATGGGCAGCCATGGGTGGG + Intronic
1043626498 8:82267195-82267217 GCTGATGGTCAGACAGAGCTGGG + Intergenic
1043734340 8:83724726-83724748 GCAGTGGGGCAGGCATGGCTGGG - Intergenic
1044053884 8:87543245-87543267 GCAGATGGGGAGGCATGGCTGGG - Intronic
1044962352 8:97543040-97543062 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1046182744 8:110673438-110673460 GGTGATAGTCACCCATGGCTTGG - Intergenic
1046305627 8:112362305-112362327 ACTGATGGGCAGCAATGCTTTGG + Intronic
1046459728 8:114518082-114518104 GCCCATGGGCAGCCATGGATGGG + Intergenic
1047204353 8:122791388-122791410 GCTGATTGGGAGCCCTGCCTGGG + Intronic
1047391046 8:124451500-124451522 GCTGCTGGGTGACCATGGCTGGG + Exonic
1047511213 8:125517204-125517226 CATGATGGGCAGCCCTTGCTTGG - Intergenic
1047817737 8:128483304-128483326 GGTGATGGGAAGCCATAGGTAGG + Intergenic
1047938741 8:129807200-129807222 GCTGATGGACAGTGAAGGCTAGG + Intergenic
1048282214 8:133113999-133114021 CCTGATGGGCAGCCAAGACTGGG - Intronic
1048348339 8:133595402-133595424 ACTGGTGCACAGCCATGGCTGGG + Intergenic
1048650177 8:136467510-136467532 GGTGATGTGCAGCAAAGGCTGGG + Intergenic
1049824003 8:144655250-144655272 GCTGATGGGTGGCCATGGGTGGG - Intergenic
1049967920 9:796063-796085 TCTGATGAGCAGACAAGGCTGGG - Intergenic
1050426336 9:5516399-5516421 GCCCATGGGCAGCCATGGAAGGG + Intronic
1051513994 9:17908261-17908283 TCTACTGTGCAGCCATGGCTGGG - Intergenic
1052437015 9:28443332-28443354 GCAGGTGGGGAGGCATGGCTGGG + Intronic
1052466804 9:28839681-28839703 GCCCATGGGCAGCCATGGGCAGG + Intergenic
1053128187 9:35599570-35599592 GGTCCTGGGCAGCCATGGGTGGG - Intergenic
1057473744 9:95381186-95381208 GCTGAGAGGCAGCCATGGGAAGG - Intergenic
1059401234 9:114071658-114071680 GCCCATGGGCGGCCATGGGTAGG - Intronic
1060003730 9:119981372-119981394 GCTGATGGGGAGACAGGGCAGGG - Intergenic
1060557267 9:124514440-124514462 CCTGATGGGCAGCCAGGCCAAGG + Intergenic
1060910093 9:127342692-127342714 GCTGATGGGCAGGCAAAGGTGGG + Intronic
1061184160 9:129042378-129042400 GCTGGTGGGCAGCCAGGGCCAGG - Exonic
1062099389 9:134720295-134720317 GCTGGTGGGCAGCCCCTGCTTGG - Intronic
1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG + Exonic
1187913706 X:24133512-24133534 GGTGCTGGGCACCCATGTCTAGG - Intergenic
1188756520 X:33969468-33969490 GTCCATGGGCAGCCATGGGTAGG - Intergenic
1189559384 X:42176753-42176775 GCAGATGGGCAGTCCTGGATAGG + Intergenic
1189737861 X:44089687-44089709 GCTTGTGGCCAGCCATGGCTAGG - Intergenic
1189975899 X:46461183-46461205 GCTGGTAGGAAGCCATGGATTGG + Intronic
1189983168 X:46530517-46530539 GCTGGTAGGAAGCCATGGATTGG - Intronic
1190279327 X:48918905-48918927 GCAGCTGGGGAGCCAGGGCTGGG + Exonic
1190360547 X:49644884-49644906 GTCCATGGGCAGCCATGGCTGGG + Intergenic
1190369515 X:49727374-49727396 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1192265327 X:69533744-69533766 GCCCATGGGCAGCCATGGGCAGG + Intergenic
1192986968 X:76409897-76409919 TCTGAAGGGCAGCAGTGGCTTGG + Intergenic
1193167980 X:78303145-78303167 GCTGATGGCCACCCATGGAGGGG - Intronic
1194205053 X:91002617-91002639 GTCCATGGGCAGCCATGGGTGGG + Intergenic
1196441465 X:115723210-115723232 GCTTCTGGGCAGCCAGTGCTGGG + Intergenic
1198256140 X:134925818-134925840 GCTGGTGGGCAGGCACTGCTGGG - Intergenic
1199191719 X:144979564-144979586 GCTGATGGCCACCCATGGAGAGG + Intergenic
1200073496 X:153540236-153540258 GCTGATGAGCAGCCCAGGGTGGG + Intronic
1200103863 X:153701726-153701748 GCTCAGGCGCAGCCATGGTTTGG - Intronic
1200550879 Y:4577760-4577782 GTCCATGGGCAGCCATGGGTGGG + Intergenic