ID: 1145889821

View in Genome Browser
Species Human (GRCh38)
Location 17:28406401-28406423
Sequence CTTGTTATCTGTGGTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145889821_1145889824 21 Left 1145889821 17:28406401-28406423 CCAGACACACCACAGATAACAAG 0: 1
1: 0
2: 1
3: 14
4: 162
Right 1145889824 17:28406445-28406467 TTGACCACTTACTATGTGCTGGG 0: 1
1: 23
2: 286
3: 1440
4: 4396
1145889821_1145889826 26 Left 1145889821 17:28406401-28406423 CCAGACACACCACAGATAACAAG 0: 1
1: 0
2: 1
3: 14
4: 162
Right 1145889826 17:28406450-28406472 CACTTACTATGTGCTGGGCACGG 0: 1
1: 4
2: 21
3: 139
4: 546
1145889821_1145889823 20 Left 1145889821 17:28406401-28406423 CCAGACACACCACAGATAACAAG 0: 1
1: 0
2: 1
3: 14
4: 162
Right 1145889823 17:28406444-28406466 ATTGACCACTTACTATGTGCTGG 0: 3
1: 17
2: 96
3: 450
4: 1292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145889821 Original CRISPR CTTGTTATCTGTGGTGTGTC TGG (reversed) Intronic
900946008 1:5831845-5831867 CGTGTTCTCTGTGTTGTGTTGGG - Intergenic
903935933 1:26894854-26894876 CTTATTGTCTCTGGTGTGTCAGG + Intronic
904605320 1:31694956-31694978 CTTGTCATCTGCAGTGTGTTCGG - Intronic
908149221 1:61282512-61282534 CTTGCATTCTGTGGTGTATCAGG + Intronic
911739116 1:101368248-101368270 CTTGTTATCTTTGGAGTAACTGG + Intergenic
912862440 1:113226015-113226037 CTTGTTATTCCTGCTGTGTCAGG - Intergenic
913281637 1:117190509-117190531 CTTGTTATCAGGTGTGTGTATGG - Intronic
913324615 1:117615851-117615873 TTTGCTATCTTTGGTGTGTATGG + Intronic
914400966 1:147319491-147319513 CTTGACATCTGTGGTGTGAAGGG + Intergenic
915021184 1:152779913-152779935 CTGGCTATCTGTCGTGTGTTTGG - Intronic
916195663 1:162219915-162219937 CTTCTTTTCTGTTGTGTGTGTGG + Intronic
919849431 1:201662667-201662689 CTGGTCATCTATGGTGTGCCAGG - Intronic
920111528 1:203590680-203590702 CTTGTTGTCTGAGCTGTGTCAGG + Intergenic
1063599745 10:7469530-7469552 TTGATTATCTGTGGAGTGTCCGG - Intergenic
1064752054 10:18540064-18540086 CTTTTTATCTGTGCTGATTCTGG - Exonic
1064831527 10:19473253-19473275 CTTGTTGTCTGTAGTATGCCAGG - Intronic
1067310767 10:45111612-45111634 GGTGTTATGTGTGGTGTGTGGGG + Intergenic
1067469477 10:46525741-46525763 ATGGTTATATGTGGTGTGTGTGG - Intergenic
1067839643 10:49665604-49665626 CTTGGGCTCTGTGGTGTGTGTGG - Intergenic
1069053384 10:63817979-63818001 ATTTTAATCTTTGGTGTGTCTGG + Intergenic
1070792522 10:79197787-79197809 TTTCTTATCTGTGCTGTGCCTGG + Intronic
1071974969 10:90946341-90946363 CTTGTGATCTGTGGAGTGGCTGG - Intergenic
1078374858 11:10785298-10785320 CTTGACAGCTGTGGTGTGGCTGG + Intergenic
1079582080 11:22078188-22078210 CTTGGTATATGTGGAGTGTCAGG - Intergenic
1081389043 11:42507234-42507256 CTTTTTATCTGTAGTGTGTTTGG + Intergenic
1086412640 11:86557894-86557916 CTGGTTATCTGTGCTGGGTGAGG - Intronic
1090609875 11:128461467-128461489 CTTGTTATCAGTGGATTCTCGGG - Exonic
1091215957 11:133902149-133902171 TTTGGTGTGTGTGGTGTGTCTGG - Intergenic
1094801810 12:34046292-34046314 CTTGTTATCTGTGAAGAGGCTGG + Intergenic
1096136038 12:49202148-49202170 ATTTTTATCTCTGGTGTTTCTGG - Intronic
1099045976 12:77720107-77720129 CTTGTTATCTTTTGTATTTCTGG + Intergenic
1099557261 12:84125255-84125277 ATTGTTATCTGTGATGGATCTGG + Intergenic
1103230582 12:119327136-119327158 CTTTTTAACTTTGGTATGTCCGG - Intergenic
1103233352 12:119350906-119350928 CTTGTCTTCAGTGGTATGTCAGG - Intronic
1105653256 13:22403722-22403744 CTTGTGAACTGTGAAGTGTCTGG - Intergenic
1111221079 13:85206036-85206058 GTTCTTAAATGTGGTGTGTCTGG - Intergenic
1111886897 13:94032751-94032773 TTTGATATCACTGGTGTGTCTGG - Intronic
1116683488 14:48008579-48008601 TTTGTGATCTGTTATGTGTCAGG + Intergenic
1117662331 14:58020580-58020602 CTTCCTGTCTGTGGTGTGTGTGG + Intronic
1120568468 14:86088531-86088553 CAAGGAATCTGTGGTGTGTCAGG - Intergenic
1120588761 14:86349437-86349459 TATGTTATCTGTAGTGTGTATGG + Intergenic
1124048720 15:26175575-26175597 CTTGTTCTCCTTGGTGGGTCTGG + Intergenic
1125198162 15:37072335-37072357 CCTGTGGTCTGTGGTGTGCCAGG + Intronic
1126595534 15:50380960-50380982 ATTGTTATCCTTGGTGTGTGTGG + Intergenic
1127187409 15:56493730-56493752 CATGTTAACTTTGGTGGGTCAGG + Intergenic
1129292424 15:74578526-74578548 CTTGTCACTTGTGGAGTGTCTGG + Intronic
1129633785 15:77292121-77292143 CTTGTTATCTGTGGTAGTTATGG + Intronic
1133173101 16:3993877-3993899 CGTAATATCTGTGCTGTGTCTGG - Intronic
1133536388 16:6706129-6706151 ATTGTAATCTTTGTTGTGTCAGG + Intronic
1137839252 16:51624852-51624874 TTTGTTTTCTTTGGTGTGTGAGG + Intergenic
1140474270 16:75230998-75231020 CTTGTTGCCTGTGCTCTGTCAGG - Intronic
1143666042 17:8361434-8361456 CTTGTTTTGTGTGGGGTGGCAGG - Intergenic
1144479493 17:15617193-15617215 CTTGATTTATTTGGTGTGTCAGG - Intronic
1144770551 17:17757163-17757185 CTTATAAACTGGGGTGTGTCTGG - Intronic
1144918807 17:18746546-18746568 CTTGATTTATTTGGTGTGTCAGG + Intronic
1145889821 17:28406401-28406423 CTTGTTATCTGTGGTGTGTCTGG - Intronic
1146640096 17:34533849-34533871 CTAGTGATCTGTGGAGTGGCGGG - Intergenic
1152932873 17:83119239-83119261 CCTGTTATCTGAGGAGTGACCGG - Intergenic
1154100615 18:11469511-11469533 CTTTTTATGTGTGATGTGTATGG + Intergenic
1158502045 18:58011121-58011143 CTTGTTCTCTGTGTTTTCTCAGG + Intergenic
1167337271 19:48894792-48894814 CTTGGTATCTGTGGGGTTCCTGG + Intronic
1168361529 19:55744920-55744942 CTTGTTAACTTTTGTGTTTCCGG - Intergenic
925016279 2:526836-526858 TTTGTAATGTGTGGTGTGTGTGG + Intergenic
925020781 2:566092-566114 TTCCTTATCTGTGGTGTTTCAGG + Intergenic
927449958 2:23200109-23200131 CCTGTTATCTGTCTTTTGTCAGG + Intergenic
929301394 2:40307684-40307706 CTGGTTACCAGAGGTGTGTCTGG + Intronic
935573255 2:104684737-104684759 CTTGATATCTCTGCTGTGTTAGG - Intergenic
935708953 2:105880748-105880770 CTTGTTATCTTTTGTGTCACTGG + Intronic
935997510 2:108789652-108789674 TTTACTATCTCTGGTGTGTCTGG + Intronic
937307366 2:120880634-120880656 CTTGCTGTCTGGGGTGTTTCAGG - Intronic
937865842 2:126751456-126751478 TTTGTGATCTGTGGGGTGGCGGG - Intergenic
938787687 2:134647594-134647616 CTTAGTATCTGTGGTGTGTAGGG - Intronic
939017161 2:136916219-136916241 TTGGTTATCTGTGGTCTGTGGGG + Intronic
939774328 2:146365840-146365862 CTCCTTACCTCTGGTGTGTCAGG + Intergenic
943059118 2:183019683-183019705 CTTGTTATCTAATGTGTGCCAGG - Intronic
946542400 2:220699009-220699031 CTTCTCATCAGTGCTGTGTCAGG - Intergenic
948937085 2:241173549-241173571 TTTATTTTCTGTGATGTGTCAGG + Intronic
949044446 2:241866027-241866049 CTTGTAGTGTGTGGTGTGTGTGG + Intergenic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169581145 20:7024575-7024597 GTTGTTTTCTGTTGTGTGTGTGG + Intergenic
1171562666 20:26139505-26139527 TTTGTTATCTGGTGTGTGTGTGG - Intergenic
1172340729 20:34155434-34155456 CTTGTTATCAGTGGTGTGCAAGG + Intergenic
1174505401 20:51014623-51014645 CTTGTTCTCTGCCGTGTCTCCGG - Intronic
1175001062 20:55631098-55631120 CTTTTTTTCAGTGGTGTGCCAGG + Intergenic
1175212741 20:57371542-57371564 CTTGTTATCTTTGGGCTTTCTGG - Intronic
1176426543 21:6552310-6552332 TTTGATATGTGTGGTGTGTGGGG - Intergenic
1176946918 21:14993162-14993184 TGTGTTATCAGTGGTGAGTCTGG + Intronic
1176983588 21:15410431-15410453 CATGGCATCTGTGGAGTGTCAGG + Intergenic
1177771135 21:25517595-25517617 GTTGTTATTTGAGGTTTGTCTGG + Intergenic
1178122981 21:29488293-29488315 CATGTTATCTGTGCAGTATCTGG - Intronic
1179702034 21:43160632-43160654 TTTGATATGTGTGGTGTGTGGGG - Intronic
1179824936 21:43958711-43958733 TTTGTGATGTGTGGTGTGTGTGG + Intronic
1179824943 21:43958822-43958844 TTTGTGATGTGTGGTGTGTGTGG + Intronic
1183009879 22:34936152-34936174 CTTGCTCTCTGTGGGGTGTCTGG + Intergenic
1183811900 22:40264865-40264887 GTTGTTATCGGTGGTGTTTTCGG - Exonic
950026322 3:9822374-9822396 CTTTTTATTTCTGGTGTGTGGGG + Intronic
955023368 3:55143170-55143192 CTAGTTATCTGTGATGGTTCTGG + Intergenic
956067528 3:65412792-65412814 CTTGTTCTCTGTGCTGAGTGAGG - Intronic
958119649 3:89268504-89268526 CTTGATATGTGTGGTCTATCTGG + Intronic
958810432 3:98854828-98854850 ATTTTTATCTGTGTTGTGTGAGG - Intronic
961213959 3:125145309-125145331 CTTATTTTCTGGGGTGTCTCTGG + Intronic
963462590 3:145636322-145636344 CTTGTTCTCTGTGCTGTCTTTGG + Intergenic
964575620 3:158163564-158163586 CTTGGTACCTGTGTTGTGTTTGG + Intronic
965673767 3:171173802-171173824 CTTGATATCTGAGCTGAGTCTGG - Intronic
967714587 3:192747954-192747976 CTTGTTATCTGAGGAGAGGCTGG + Intronic
970190000 4:13506462-13506484 CTTGTTATGTGTAGGGTGTTAGG - Intergenic
970768464 4:19580370-19580392 CTTGCTTTCTGCGGTATGTCTGG - Intergenic
971999098 4:34006872-34006894 CTTGATATCTGGTGTGTGTGTGG + Intergenic
974413053 4:61566568-61566590 CGTGGTATCTGTGGTATGTATGG + Intronic
976656672 4:87496156-87496178 CTTTCTATCTGTGGTTTGACAGG + Intronic
976715830 4:88121761-88121783 CAGTTTATCCGTGGTGTGTCTGG - Exonic
978322841 4:107516913-107516935 CTTGATATCTCTTGTGTATCTGG - Intergenic
984165955 4:176303543-176303565 TTTCTTATCTGGGGAGTGTCTGG - Intergenic
984944316 4:184959443-184959465 TTTTTTATCTGTGTTGTCTCCGG + Intergenic
985183582 4:187292014-187292036 CTAGTTATCTGTATAGTGTCTGG + Intergenic
986296995 5:6447806-6447828 CATGATATGTGTGGTGTGTGTGG - Intergenic
986835547 5:11633185-11633207 CGTGTTAACTCTGATGTGTCTGG - Intronic
986857641 5:11889258-11889280 TGTGTTACCTGTGGTGTGTCTGG - Intronic
987537917 5:19211742-19211764 CTTTTTTTCTGTAGTGAGTCTGG - Intergenic
990033579 5:51291985-51292007 CCTGATATCTGTGGTATATCAGG + Intergenic
993386667 5:87269073-87269095 CTTTTCATCTGTGGTTTGTTAGG + Intronic
995059163 5:107795225-107795247 CTTGTGGCCTGTGGTGTGGCTGG - Intergenic
995399820 5:111728391-111728413 CTTGATATGTGTGTTATGTCAGG - Intronic
996344314 5:122473165-122473187 CTTTTGGTTTGTGGTGTGTCTGG - Intergenic
998735610 5:145136683-145136705 CTTGTTATCTTTTGTCTGTTTGG + Intergenic
1002977226 6:2092510-2092532 CTTGGTAAATGTGTTGTGTCTGG + Intronic
1004418336 6:15445623-15445645 CTTGTTGCATGAGGTGTGTCAGG + Intronic
1004953896 6:20705881-20705903 CTTGTCCTGTGTGGTGGGTCTGG + Intronic
1005417665 6:25619049-25619071 CCTGTTCTCTGTGCTGTGTGAGG + Intronic
1009023784 6:57973326-57973348 CTTATTTTCTGTGATGTCTCAGG + Intergenic
1009199362 6:60724877-60724899 CTTATTTTCTGTGATGTCTCAGG + Intergenic
1009931430 6:70181188-70181210 TTTGTTTGCTGTGGTGTGTATGG + Intronic
1011336424 6:86266395-86266417 AGTGCTGTCTGTGGTGTGTCTGG + Intergenic
1012632716 6:101492788-101492810 TTTGTTTTCTGTGCTGTCTCTGG - Intronic
1015989632 6:138924325-138924347 TTTGTTATCTCTAGTGTGTCAGG - Intronic
1017504157 6:155052106-155052128 CTTGTTACCTGTGGTCTCTGTGG + Intronic
1019264851 7:109250-109272 CATTTTATCTGGGGTGTGGCAGG - Intergenic
1022871167 7:34481433-34481455 CTTATTATCTCTTGGGTGTCAGG + Intergenic
1024158050 7:46646679-46646701 CTGGTTATCTGTTGGCTGTCAGG + Intergenic
1024382414 7:48713122-48713144 CTTGGTTTATATGGTGTGTCTGG + Intergenic
1024895164 7:54251344-54251366 CTTGTTAAATGTGCTGTATCTGG + Intergenic
1027269197 7:76510911-76510933 GCTGTTATCTGTGGTGTGTAGGG - Exonic
1027319911 7:77004806-77004828 GCTGTTATCTGTGGTGTGTAGGG - Intergenic
1031236025 7:119178057-119178079 CTCCTTATCTGTGCAGTGTCTGG + Intergenic
1031514502 7:122685451-122685473 CTTGTCATCTGAGAAGTGTCAGG - Intronic
1032239854 7:130152302-130152324 TTTTTTATTTGTGGTGTGTGTGG - Intergenic
1035367704 7:158360019-158360041 CTTGGGATCTGTGGGTTGTCTGG - Intronic
1035382887 7:158451190-158451212 CTTGTTCTCAGTGATTTGTCAGG + Intronic
1036921231 8:12857275-12857297 CTTGTCATCTGTGGTTTTACGGG + Intergenic
1038186216 8:25277489-25277511 CTTGTTCCCTGTGCTGTATCTGG - Intronic
1038272030 8:26082998-26083020 CTTGTTCTCTGTGGTGTCTCTGG - Intergenic
1043103315 8:76075060-76075082 CATCTTATCTGGGGTGAGTCTGG + Intergenic
1043626978 8:82273768-82273790 CTGGTTATCTGTAGTATCTCTGG - Intergenic
1044599632 8:93991043-93991065 CTTGTTTTCTGGGGTTTGCCTGG - Intergenic
1045918342 8:107500503-107500525 CATATTATCTTTAGTGTGTCAGG - Intergenic
1046072765 8:109278565-109278587 CTTGTTATCTCTAGGGTGTAGGG - Intronic
1046399970 8:113692035-113692057 CTTGTCCACTGTGGTGTGGCTGG + Intergenic
1046649190 8:116818373-116818395 TTTATTATCTGTGCTGTGTCAGG + Intronic
1047283974 8:123470589-123470611 CTTTTTAAAGGTGGTGTGTCTGG - Intergenic
1047381166 8:124364928-124364950 CTGGTTTCCTTTGGTGTGTCTGG - Intronic
1047407790 8:124599581-124599603 TTTGTTATATTTGGTGTGTGTGG - Intronic
1048688700 8:136934044-136934066 CTTGTTATCTGTAAGGTTTCTGG + Intergenic
1052287772 9:26806380-26806402 AATGTTATCTACGGTGTGTCAGG - Intergenic
1056756201 9:89383454-89383476 CTGGTGTTTTGTGGTGTGTCTGG - Intronic
1058091091 9:100806333-100806355 CTTACTATCTGTGGTATATCTGG - Intergenic
1058488767 9:105471316-105471338 ATTGATATCTGTTGTTTGTCGGG + Intronic
1059113890 9:111583545-111583567 CTTGAAATCTGTGGTGTGAAGGG - Exonic
1060814985 9:126630447-126630469 GTTGTTATCTGTGACCTGTCTGG + Intronic
1187095188 X:16140667-16140689 CGTGTTAACTGTGGTTTCTCAGG + Intronic
1189327322 X:40120686-40120708 TTTGTTTCCTGGGGTGTGTCGGG - Intronic
1189462310 X:41252828-41252850 CTTGTCAGCTGTGGTGTGCCAGG - Intergenic
1189925686 X:45952158-45952180 CTTTGTATCTCTGGTGAGTCAGG - Intergenic
1191039908 X:56068135-56068157 CTGGCTATCAGTGGTGTGGCTGG - Intergenic
1192293462 X:69822381-69822403 CTGATTAACTGTAGTGTGTCTGG + Intronic
1193044086 X:77033774-77033796 CTTGTTATCAGTGGTGGGGGTGG - Intergenic
1196885199 X:120237758-120237780 CTGGTTATCTGTAAAGTGTCTGG + Intergenic
1196927424 X:120647296-120647318 CTTGTTTTTTGAGGTCTGTCTGG + Intergenic
1199279235 X:145980679-145980701 CTTGTTATCTGTTGTCTCTAAGG + Intergenic