ID: 1145889979

View in Genome Browser
Species Human (GRCh38)
Location 17:28407478-28407500
Sequence ACGTGCCAGGCACTGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145889972_1145889979 18 Left 1145889972 17:28407437-28407459 CCTATCTTTCATTCATTCAGCTC No data
Right 1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG No data
1145889971_1145889979 19 Left 1145889971 17:28407436-28407458 CCCTATCTTTCATTCATTCAGCT No data
Right 1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG No data
1145889969_1145889979 27 Left 1145889969 17:28407428-28407450 CCTTACTCCCCTATCTTTCATTC No data
Right 1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG No data
1145889970_1145889979 20 Left 1145889970 17:28407435-28407457 CCCCTATCTTTCATTCATTCAGC No data
Right 1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145889979 Original CRISPR ACGTGCCAGGCACTGTGCTG GGG Intergenic
No off target data available for this crispr