ID: 1145890031

View in Genome Browser
Species Human (GRCh38)
Location 17:28407751-28407773
Sequence CATCCATCCTCCCAAGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890031_1145890035 9 Left 1145890031 17:28407751-28407773 CCTGATTCTTGGGAGGATGGATG No data
Right 1145890035 17:28407783-28407805 CTGGCCACTGTGACTGTGCCTGG No data
1145890031_1145890033 -10 Left 1145890031 17:28407751-28407773 CCTGATTCTTGGGAGGATGGATG No data
Right 1145890033 17:28407764-28407786 AGGATGGATGGCTCCAATTCTGG No data
1145890031_1145890038 18 Left 1145890031 17:28407751-28407773 CCTGATTCTTGGGAGGATGGATG No data
Right 1145890038 17:28407792-28407814 GTGACTGTGCCTGGGCCTGTTGG No data
1145890031_1145890036 10 Left 1145890031 17:28407751-28407773 CCTGATTCTTGGGAGGATGGATG No data
Right 1145890036 17:28407784-28407806 TGGCCACTGTGACTGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890031 Original CRISPR CATCCATCCTCCCAAGAATC AGG (reversed) Intergenic