ID: 1145890037

View in Genome Browser
Species Human (GRCh38)
Location 17:28407787-28407809
Sequence AGGCCCAGGCACAGTCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890037_1145890041 16 Left 1145890037 17:28407787-28407809 CCACTGTGACTGTGCCTGGGCCT No data
Right 1145890041 17:28407826-28407848 TACCCCACCTCCCCTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890037 Original CRISPR AGGCCCAGGCACAGTCACAG TGG (reversed) Intergenic