ID: 1145890038

View in Genome Browser
Species Human (GRCh38)
Location 17:28407792-28407814
Sequence GTGACTGTGCCTGGGCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890034_1145890038 -8 Left 1145890034 17:28407777-28407799 CCAATTCTGGCCACTGTGACTGT No data
Right 1145890038 17:28407792-28407814 GTGACTGTGCCTGGGCCTGTTGG No data
1145890028_1145890038 27 Left 1145890028 17:28407742-28407764 CCTGACAGGCCTGATTCTTGGGA No data
Right 1145890038 17:28407792-28407814 GTGACTGTGCCTGGGCCTGTTGG No data
1145890031_1145890038 18 Left 1145890031 17:28407751-28407773 CCTGATTCTTGGGAGGATGGATG No data
Right 1145890038 17:28407792-28407814 GTGACTGTGCCTGGGCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890038 Original CRISPR GTGACTGTGCCTGGGCCTGT TGG Intergenic