ID: 1145890039

View in Genome Browser
Species Human (GRCh38)
Location 17:28407801-28407823
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890039_1145890052 22 Left 1145890039 17:28407801-28407823 CCTGGGCCTGTTGGAGCTTGTTA No data
Right 1145890052 17:28407846-28407868 AGGAGTCCGAGACTCAGGATGGG No data
1145890039_1145890051 21 Left 1145890039 17:28407801-28407823 CCTGGGCCTGTTGGAGCTTGTTA No data
Right 1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG No data
1145890039_1145890041 2 Left 1145890039 17:28407801-28407823 CCTGGGCCTGTTGGAGCTTGTTA No data
Right 1145890041 17:28407826-28407848 TACCCCACCTCCCCTGAGCCAGG No data
1145890039_1145890053 26 Left 1145890039 17:28407801-28407823 CCTGGGCCTGTTGGAGCTTGTTA No data
Right 1145890053 17:28407850-28407872 GTCCGAGACTCAGGATGGGTAGG No data
1145890039_1145890049 17 Left 1145890039 17:28407801-28407823 CCTGGGCCTGTTGGAGCTTGTTA No data
Right 1145890049 17:28407841-28407863 GAGCCAGGAGTCCGAGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890039 Original CRISPR TAACAAGCTCCAACAGGCCC AGG (reversed) Intergenic