ID: 1145890040

View in Genome Browser
Species Human (GRCh38)
Location 17:28407807-28407829
Sequence GGTAGCTAACAAGCTCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890040_1145890052 16 Left 1145890040 17:28407807-28407829 CCTGTTGGAGCTTGTTAGCTACC No data
Right 1145890052 17:28407846-28407868 AGGAGTCCGAGACTCAGGATGGG No data
1145890040_1145890049 11 Left 1145890040 17:28407807-28407829 CCTGTTGGAGCTTGTTAGCTACC No data
Right 1145890049 17:28407841-28407863 GAGCCAGGAGTCCGAGACTCAGG No data
1145890040_1145890041 -4 Left 1145890040 17:28407807-28407829 CCTGTTGGAGCTTGTTAGCTACC No data
Right 1145890041 17:28407826-28407848 TACCCCACCTCCCCTGAGCCAGG No data
1145890040_1145890051 15 Left 1145890040 17:28407807-28407829 CCTGTTGGAGCTTGTTAGCTACC No data
Right 1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG No data
1145890040_1145890055 26 Left 1145890040 17:28407807-28407829 CCTGTTGGAGCTTGTTAGCTACC No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data
1145890040_1145890053 20 Left 1145890040 17:28407807-28407829 CCTGTTGGAGCTTGTTAGCTACC No data
Right 1145890053 17:28407850-28407872 GTCCGAGACTCAGGATGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890040 Original CRISPR GGTAGCTAACAAGCTCCAAC AGG (reversed) Intergenic