ID: 1145890041

View in Genome Browser
Species Human (GRCh38)
Location 17:28407826-28407848
Sequence TACCCCACCTCCCCTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890040_1145890041 -4 Left 1145890040 17:28407807-28407829 CCTGTTGGAGCTTGTTAGCTACC No data
Right 1145890041 17:28407826-28407848 TACCCCACCTCCCCTGAGCCAGG No data
1145890037_1145890041 16 Left 1145890037 17:28407787-28407809 CCACTGTGACTGTGCCTGGGCCT No data
Right 1145890041 17:28407826-28407848 TACCCCACCTCCCCTGAGCCAGG No data
1145890039_1145890041 2 Left 1145890039 17:28407801-28407823 CCTGGGCCTGTTGGAGCTTGTTA No data
Right 1145890041 17:28407826-28407848 TACCCCACCTCCCCTGAGCCAGG No data
1145890034_1145890041 26 Left 1145890034 17:28407777-28407799 CCAATTCTGGCCACTGTGACTGT No data
Right 1145890041 17:28407826-28407848 TACCCCACCTCCCCTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890041 Original CRISPR TACCCCACCTCCCCTGAGCC AGG Intergenic
No off target data available for this crispr