ID: 1145890042

View in Genome Browser
Species Human (GRCh38)
Location 17:28407828-28407850
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890042_1145890052 -5 Left 1145890042 17:28407828-28407850 CCCCACCTCCCCTGAGCCAGGAG No data
Right 1145890052 17:28407846-28407868 AGGAGTCCGAGACTCAGGATGGG No data
1145890042_1145890049 -10 Left 1145890042 17:28407828-28407850 CCCCACCTCCCCTGAGCCAGGAG No data
Right 1145890049 17:28407841-28407863 GAGCCAGGAGTCCGAGACTCAGG No data
1145890042_1145890055 5 Left 1145890042 17:28407828-28407850 CCCCACCTCCCCTGAGCCAGGAG No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data
1145890042_1145890053 -1 Left 1145890042 17:28407828-28407850 CCCCACCTCCCCTGAGCCAGGAG No data
Right 1145890053 17:28407850-28407872 GTCCGAGACTCAGGATGGGTAGG No data
1145890042_1145890051 -6 Left 1145890042 17:28407828-28407850 CCCCACCTCCCCTGAGCCAGGAG No data
Right 1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890042 Original CRISPR CTCCTGGCTCAGGGGAGGTG GGG (reversed) Intergenic