ID: 1145890044

View in Genome Browser
Species Human (GRCh38)
Location 17:28407830-28407852
Sequence GACTCCTGGCTCAGGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890044_1145890053 -3 Left 1145890044 17:28407830-28407852 CCACCTCCCCTGAGCCAGGAGTC No data
Right 1145890053 17:28407850-28407872 GTCCGAGACTCAGGATGGGTAGG No data
1145890044_1145890052 -7 Left 1145890044 17:28407830-28407852 CCACCTCCCCTGAGCCAGGAGTC No data
Right 1145890052 17:28407846-28407868 AGGAGTCCGAGACTCAGGATGGG No data
1145890044_1145890051 -8 Left 1145890044 17:28407830-28407852 CCACCTCCCCTGAGCCAGGAGTC No data
Right 1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG No data
1145890044_1145890055 3 Left 1145890044 17:28407830-28407852 CCACCTCCCCTGAGCCAGGAGTC No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890044 Original CRISPR GACTCCTGGCTCAGGGGAGG TGG (reversed) Intergenic