ID: 1145890045

View in Genome Browser
Species Human (GRCh38)
Location 17:28407833-28407855
Sequence TCGGACTCCTGGCTCAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890045_1145890053 -6 Left 1145890045 17:28407833-28407855 CCTCCCCTGAGCCAGGAGTCCGA No data
Right 1145890053 17:28407850-28407872 GTCCGAGACTCAGGATGGGTAGG No data
1145890045_1145890055 0 Left 1145890045 17:28407833-28407855 CCTCCCCTGAGCCAGGAGTCCGA No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data
1145890045_1145890052 -10 Left 1145890045 17:28407833-28407855 CCTCCCCTGAGCCAGGAGTCCGA No data
Right 1145890052 17:28407846-28407868 AGGAGTCCGAGACTCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890045 Original CRISPR TCGGACTCCTGGCTCAGGGG AGG (reversed) Intergenic
No off target data available for this crispr