ID: 1145890048 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:28407838-28407860 |
Sequence | GAGTCTCGGACTCCTGGCTC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1145890048_1145890055 | -5 | Left | 1145890048 | 17:28407838-28407860 | CCTGAGCCAGGAGTCCGAGACTC | No data | ||
Right | 1145890055 | 17:28407856-28407878 | GACTCAGGATGGGTAGGTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1145890048 | Original CRISPR | GAGTCTCGGACTCCTGGCTC AGG (reversed) | Intergenic | ||