ID: 1145890048

View in Genome Browser
Species Human (GRCh38)
Location 17:28407838-28407860
Sequence GAGTCTCGGACTCCTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890048_1145890055 -5 Left 1145890048 17:28407838-28407860 CCTGAGCCAGGAGTCCGAGACTC No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890048 Original CRISPR GAGTCTCGGACTCCTGGCTC AGG (reversed) Intergenic
No off target data available for this crispr