ID: 1145890049

View in Genome Browser
Species Human (GRCh38)
Location 17:28407841-28407863
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890040_1145890049 11 Left 1145890040 17:28407807-28407829 CCTGTTGGAGCTTGTTAGCTACC No data
Right 1145890049 17:28407841-28407863 GAGCCAGGAGTCCGAGACTCAGG No data
1145890039_1145890049 17 Left 1145890039 17:28407801-28407823 CCTGGGCCTGTTGGAGCTTGTTA No data
Right 1145890049 17:28407841-28407863 GAGCCAGGAGTCCGAGACTCAGG No data
1145890042_1145890049 -10 Left 1145890042 17:28407828-28407850 CCCCACCTCCCCTGAGCCAGGAG No data
Right 1145890049 17:28407841-28407863 GAGCCAGGAGTCCGAGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890049 Original CRISPR GAGCCAGGAGTCCGAGACTC AGG Intergenic
No off target data available for this crispr