ID: 1145890051

View in Genome Browser
Species Human (GRCh38)
Location 17:28407845-28407867
Sequence CAGGAGTCCGAGACTCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890039_1145890051 21 Left 1145890039 17:28407801-28407823 CCTGGGCCTGTTGGAGCTTGTTA No data
Right 1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG No data
1145890040_1145890051 15 Left 1145890040 17:28407807-28407829 CCTGTTGGAGCTTGTTAGCTACC No data
Right 1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG No data
1145890044_1145890051 -8 Left 1145890044 17:28407830-28407852 CCACCTCCCCTGAGCCAGGAGTC No data
Right 1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG No data
1145890042_1145890051 -6 Left 1145890042 17:28407828-28407850 CCCCACCTCCCCTGAGCCAGGAG No data
Right 1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG No data
1145890043_1145890051 -7 Left 1145890043 17:28407829-28407851 CCCACCTCCCCTGAGCCAGGAGT No data
Right 1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890051 Original CRISPR CAGGAGTCCGAGACTCAGGA TGG Intergenic
No off target data available for this crispr