ID: 1145890055

View in Genome Browser
Species Human (GRCh38)
Location 17:28407856-28407878
Sequence GACTCAGGATGGGTAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145890045_1145890055 0 Left 1145890045 17:28407833-28407855 CCTCCCCTGAGCCAGGAGTCCGA No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data
1145890042_1145890055 5 Left 1145890042 17:28407828-28407850 CCCCACCTCCCCTGAGCCAGGAG No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data
1145890047_1145890055 -4 Left 1145890047 17:28407837-28407859 CCCTGAGCCAGGAGTCCGAGACT No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data
1145890046_1145890055 -3 Left 1145890046 17:28407836-28407858 CCCCTGAGCCAGGAGTCCGAGAC No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data
1145890044_1145890055 3 Left 1145890044 17:28407830-28407852 CCACCTCCCCTGAGCCAGGAGTC No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data
1145890043_1145890055 4 Left 1145890043 17:28407829-28407851 CCCACCTCCCCTGAGCCAGGAGT No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data
1145890040_1145890055 26 Left 1145890040 17:28407807-28407829 CCTGTTGGAGCTTGTTAGCTACC No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data
1145890048_1145890055 -5 Left 1145890048 17:28407838-28407860 CCTGAGCCAGGAGTCCGAGACTC No data
Right 1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145890055 Original CRISPR GACTCAGGATGGGTAGGTGC TGG Intergenic
No off target data available for this crispr