ID: 1145897628

View in Genome Browser
Species Human (GRCh38)
Location 17:28469642-28469664
Sequence TGATATCTAGGGCACTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145897628 Original CRISPR TGATATCTAGGGCACTTTGC AGG Intronic
903653321 1:24933951-24933973 TGAGTTCTAGGGCACTGGGCAGG - Intronic
905481041 1:38262145-38262167 TGATCTCTAGGGGACTTTCCAGG + Intergenic
905589947 1:39154546-39154568 TGATTTCTAGGGGGCTTTGGGGG + Intronic
905812510 1:40923086-40923108 TGCTAACTAGGTCACCTTGCAGG + Intergenic
906299179 1:44669714-44669736 TGAGATCCAGGCCTCTTTGCAGG - Intronic
908205373 1:61842672-61842694 GGATATCTTGAGCACTTTGCAGG - Intronic
908533013 1:65051557-65051579 AGCTGTCTAGGGCACTTTGCTGG - Intergenic
914892226 1:151636148-151636170 TTTTATCTAGGGCACTCTGTTGG - Intronic
917035029 1:170739206-170739228 TGATTTGTAGGGTACTTGGCAGG + Exonic
919314944 1:195960508-195960530 TGCTATCTAGAACACTTTTCGGG + Intergenic
919369148 1:196702997-196703019 GAATATCTGGGGCACTTTGTTGG - Intronic
921536088 1:216350622-216350644 TCATATCCAGGGCACATTGGTGG + Intronic
1064555497 10:16543261-16543283 GGCTGTCTAGGGCACTTTGTGGG + Intergenic
1071732803 10:88266056-88266078 TTTTATCTAGGGCACTTTATTGG + Intergenic
1073938593 10:108665587-108665609 TGACATCTAAGGCATTGTGCAGG - Intergenic
1075744526 10:124717538-124717560 TCATAGCCAGGGCACTTTGATGG - Intronic
1077727687 11:4691927-4691949 TCTTCTCTAGGGCCCTTTGCTGG + Intronic
1078320974 11:10334278-10334300 TGATATCTAGCATACTGTGCTGG - Intronic
1080383345 11:31796448-31796470 TGCTATTTAGGGCGCTTGGCTGG + Intronic
1081477169 11:43445949-43445971 TTATGTCTATGGCACTTTCCTGG - Intronic
1088704787 11:112452212-112452234 TGGGATCTAGGTCACATTGCAGG + Intergenic
1090270947 11:125385775-125385797 TCATTTCTAGGGCATTTTGAAGG - Intronic
1091661743 12:2389364-2389386 TGAACTCTAGGACACTGTGCTGG + Intronic
1094835450 12:34320021-34320043 GGATCCCTAGGGCCCTTTGCAGG + Intergenic
1096909987 12:54973740-54973762 TGACATCTTGGGCACTTTCCAGG - Intronic
1096934860 12:55260862-55260884 TAATATCTAGAGAAGTTTGCAGG - Intergenic
1097960630 12:65528925-65528947 GGTTCTCTGGGGCACTTTGCTGG - Intergenic
1098216696 12:68228035-68228057 TGTTATTTAGGACACTTTGGGGG - Intergenic
1101581825 12:106048657-106048679 TGATATCTGTGGCAATGTGCTGG + Intergenic
1106809539 13:33346574-33346596 TGCTATCTAGGGCATTCTGAAGG - Intronic
1107187742 13:37544760-37544782 TCATATTTAGTGCACTTTTCAGG + Intergenic
1109327461 13:60885558-60885580 TGACATCTCCAGCACTTTGCAGG - Intergenic
1111095827 13:83514175-83514197 TGATATCTTAGGCAATGTGCTGG + Intergenic
1116044189 14:39722803-39722825 TGATACCCAAGGCACTGTGCTGG - Intergenic
1122175636 14:99916528-99916550 TTAGATAAAGGGCACTTTGCAGG - Intronic
1122680460 14:103457365-103457387 TCATACCTAAGGCACTGTGCTGG + Intronic
1125033506 15:35096750-35096772 TGCTAACAAGGGAACTTTGCAGG + Intergenic
1126324520 15:47462334-47462356 TGCTATGTAAGGCACTGTGCTGG - Intronic
1127979411 15:64023733-64023755 TGCTATCTACGGCCATTTGCTGG + Intronic
1129140217 15:73591192-73591214 TGATAGCAAGGGCATTCTGCAGG - Intronic
1130011742 15:80157739-80157761 TAATGCCTAGGGAACTTTGCAGG + Intronic
1133323173 16:4927050-4927072 TGATAAATAGGGCACTATGGTGG + Intronic
1137541010 16:49361703-49361725 TGATTTCTAAAACACTTTGCAGG + Intergenic
1138360328 16:56422810-56422832 TGTTATTTTGGGCACTTTGGAGG - Intronic
1139121202 16:64019607-64019629 TGATTTCTAGGGCACAGAGCTGG + Intergenic
1141761157 16:86029504-86029526 TGGTTTCTAGGGCGCTTTGGTGG + Intergenic
1143374785 17:6461149-6461171 TCAGATCTAGGGCAAGTTGCCGG + Intronic
1144478161 17:15607050-15607072 AGATATCTATAGTACTTTGCTGG + Intronic
1144920134 17:18756656-18756678 AGATATCTATAGTACTTTGCTGG - Intronic
1145897628 17:28469642-28469664 TGATATCTAGGGCACTTTGCAGG + Intronic
1149676296 17:58465545-58465567 TGAGATCAAGGGGACTTAGCTGG - Intronic
1153024391 18:659498-659520 TGATCTCTGGCCCACTTTGCGGG + Intronic
1156807260 18:41200342-41200364 TGATATTTAGGCCAGATTGCTGG + Intergenic
1160114325 18:76063570-76063592 TGCTATTTGGGGCACTTTGGTGG - Intergenic
1162408296 19:10489222-10489244 TGATCCCCAGGGCACTTCGCCGG + Exonic
1163690303 19:18735074-18735096 TGAGATCTGGGGCTCTTTGCTGG + Intronic
1164351665 19:27352868-27352890 GGATATTTGGGGCACTTTGAGGG - Intergenic
926186575 2:10695525-10695547 TGATCTCTAGGGCCTCTTGCAGG - Intergenic
930931686 2:56892290-56892312 TGATGACTGGGGCACTTTGGAGG - Intergenic
931189104 2:59982527-59982549 ATATTTGTAGGGCACTTTGCAGG - Intergenic
931707992 2:64963695-64963717 TGTGACCTAGGGGACTTTGCTGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933412411 2:81942526-81942548 TCATATGTATGGCAGTTTGCAGG + Intergenic
934724700 2:96608411-96608433 TGATATCTATGGCTTTTTTCAGG - Intronic
936915228 2:117633373-117633395 TGAGATCTAGAGCTCTCTGCAGG - Intergenic
939920883 2:148111520-148111542 GGTTGTCTAGGACACTTTGCAGG + Intronic
1175928897 20:62484394-62484416 TGTGTTCCAGGGCACTTTGCAGG + Intergenic
1180506606 22:16016008-16016030 GGATATTTGGAGCACTTTGCGGG - Intergenic
1181979211 22:26754046-26754068 TGAAATCGGGGGCACTTTGGGGG - Intergenic
1203332049 22_KI270739v1_random:5760-5782 GGATATTTGGAGCACTTTGCGGG + Intergenic
949386624 3:3509781-3509803 TCATATCTAAGGCACTGTGCTGG + Intergenic
953671991 3:44970507-44970529 TGATTGCTAGGGCCCCTTGCAGG + Intronic
955802884 3:62704443-62704465 TGATATCTAAGGAAATTTGGTGG + Intronic
956163283 3:66377175-66377197 TGATACCAAGGGGACTGTGCAGG + Intronic
960260160 3:115558449-115558471 TGATATCCAAGGAACCTTGCAGG + Intergenic
965389295 3:168085010-168085032 TGACATCTTCAGCACTTTGCTGG - Intronic
965766409 3:172135356-172135378 TTATAACTGGTGCACTTTGCAGG + Intronic
966953998 3:184854355-184854377 TGATCCCTAGGACACTGTGCTGG - Intronic
967097861 3:186192471-186192493 AGCTTTCTAGGGCACTGTGCTGG + Intronic
977079933 4:92512502-92512524 TGATATCTGGAGCTATTTGCTGG - Intronic
984497350 4:180515461-180515483 TGATAGATTGGGCACTGTGCTGG + Intergenic
985478911 5:95035-95057 TGATATCTGGGACACTTTTCTGG + Intergenic
987197164 5:15537994-15538016 TGATATTTAAGGCACTTTTCTGG - Intronic
989113121 5:37926593-37926615 TGGTATCTTGGGGACCTTGCTGG - Intergenic
989718405 5:44493480-44493502 TGATGCCTAGTGCACATTGCTGG + Intergenic
989863491 5:46415355-46415377 TGATATTTGGAGCACTTTGATGG + Intergenic
994519389 5:100811666-100811688 TAATTTTTAGAGCACTTTGCAGG + Exonic
998813473 5:145989103-145989125 TTGCATCTGGGGCACTTTGCTGG - Intronic
1000231153 5:159316493-159316515 TGTTATGTAGGACACTGTGCTGG - Intronic
1202776616 5_GL000208v1_random:83511-83533 TGATATTTGGGGCGCTTTGAGGG - Intergenic
1202776877 5_GL000208v1_random:87939-87961 TGATATTTGGGGCGCTTTGAGGG - Intergenic
1006598139 6:35208586-35208608 TCATATCCAGGGCTGTTTGCCGG - Intergenic
1010984359 6:82405655-82405677 TGATATTTAGGGCCATGTGCAGG + Intergenic
1011459125 6:87585239-87585261 TTATGTTTCGGGCACTTTGCTGG + Intronic
1012924273 6:105251777-105251799 TGACATCTTGGGGGCTTTGCTGG - Intergenic
1015818419 6:137234179-137234201 TTATATCTCGGGGACTTTTCAGG + Intergenic
1020205172 7:6109027-6109049 TGATTTCTACGGTACTGTGCTGG - Intronic
1023558709 7:41449986-41450008 TGTTTTCTTGGGCACTTTACAGG + Intergenic
1023722193 7:43108208-43108230 TGACATCTTAGGGACTTTGCAGG + Intergenic
1028246336 7:88483056-88483078 TTATTTCTATGTCACTTTGCTGG + Intergenic
1030173096 7:106624722-106624744 TGATATATAGGGCACTGTAAGGG - Intergenic
1035768475 8:2127408-2127430 TGAGGTCTAGGGAACTGTGCGGG - Intronic
1041254726 8:55970395-55970417 TGATATTTTGGGCACATTGTGGG - Intronic
1042783340 8:72517789-72517811 TGATGTATAGGGCAGTTTGCAGG + Intergenic
1043871309 8:85436480-85436502 TGATATATTGGGCAATTTGTAGG - Intronic
1060077763 9:120608732-120608754 TGAGATCTAGGGAACATTGGAGG - Intronic
1061748592 9:132758142-132758164 TGAGCTCTTGGGCACTTTGGTGG + Intronic
1185523271 X:757822-757844 TGATATCTAAGGCTGTTTTCTGG + Intergenic
1191114075 X:56833323-56833345 AGATATTCAGGGCACTTTTCTGG - Intergenic
1193338337 X:80317113-80317135 TGATATTTAGGGTATTTTTCTGG - Intergenic
1195467041 X:105190947-105190969 GGACACCCAGGGCACTTTGCAGG + Intronic
1197952398 X:131911831-131911853 TGATATTTTGGGCACTAAGCAGG + Intergenic
1199879670 X:151963615-151963637 TGAAATCTAGAGCACCTTCCTGG + Intronic